Incidental Mutation 'R0016:Gm9833'
ID32683
Institutional Source Beutler Lab
Gene Symbol Gm9833
Ensembl Gene ENSMUSG00000049230
Gene Namepredicted gene 9833
Synonyms
MMRRC Submission 038311-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R0016 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location10088110-10092565 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10089319 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 383 (M383L)
Ref Sequence ENSEMBL: ENSMUSP00000058811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061419]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061419
AA Change: M383L

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058811
Gene: ENSMUSG00000049230
AA Change: M383L

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 351 376 N/A INTRINSIC
low complexity region 382 410 N/A INTRINSIC
Pfam:RRM_1 459 497 1.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194684
Meta Mutation Damage Score 0.0987 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,294,800 V1181G probably benign Het
Adamts12 A T 15: 11,217,829 I291F probably damaging Het
Aspm G C 1: 139,479,544 Q2056H probably benign Het
BC067074 T C 13: 113,366,105 Y115H probably damaging Het
C7 A T 15: 5,046,924 V122E probably benign Het
Casp12 A T 9: 5,352,844 Q152L probably null Het
Cdh16 T A 8: 104,617,632 T92S probably benign Het
Chrd G C 16: 20,734,308 V162L possibly damaging Het
Cpne8 A G 15: 90,501,405 probably benign Het
Cyp2j7 T A 4: 96,202,147 I347F probably damaging Het
Cyp4a10 A T 4: 115,521,107 Q130L probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Dgkd T C 1: 87,917,952 S294P probably benign Het
Dnah8 A G 17: 30,663,316 I621V probably benign Het
Dync2h1 A G 9: 7,144,346 probably benign Het
Echdc1 A T 10: 29,322,421 probably benign Het
Elovl3 T A 19: 46,132,158 F30Y probably damaging Het
Fa2h T C 8: 111,393,514 Y80C probably damaging Het
Fam208b A C 13: 3,585,170 probably null Het
Fgd3 C T 13: 49,296,609 D55N probably benign Het
Fhod1 T C 8: 105,331,655 E823G possibly damaging Het
Gapvd1 A G 2: 34,699,913 probably benign Het
Gm17067 A T 7: 42,708,622 I152K probably benign Het
Gm1966 G A 7: 106,603,246 L264F probably benign Het
Kif27 A G 13: 58,354,714 V50A probably damaging Het
Kpna2 T C 11: 106,991,086 T305A probably benign Het
Krtap22-2 A G 16: 89,010,519 probably benign Het
Lrp2bp T A 8: 46,012,031 F62L probably damaging Het
Marf1 G A 16: 14,152,265 H197Y probably damaging Het
Mob3b A G 4: 35,083,947 F81L probably benign Het
Mon2 C T 10: 123,035,546 V389M probably damaging Het
Myh8 A G 11: 67,298,525 K1176E probably damaging Het
Naf1 T C 8: 66,889,055 probably benign Het
Nckap1l A G 15: 103,475,636 T554A probably benign Het
Oog3 A G 4: 144,158,071 Y432H probably damaging Het
Paxbp1 A T 16: 91,036,036 probably benign Het
Phf20 A T 2: 156,267,194 K154* probably null Het
Plekhj1 T C 10: 80,796,416 D74G possibly damaging Het
Plpp4 T C 7: 129,323,424 C128R probably damaging Het
Rcan3 A T 4: 135,418,378 probably null Het
Sh3rf1 T A 8: 61,374,138 M642K probably benign Het
Slc7a1 A G 5: 148,334,583 V522A probably benign Het
Sorbs1 A G 19: 40,314,738 probably benign Het
Spry2 C T 14: 105,893,297 V152M probably benign Het
Srgap2 A G 1: 131,349,462 M349T possibly damaging Het
Stag3 A G 5: 138,291,381 H271R possibly damaging Het
Stat4 T C 1: 52,068,780 V136A probably benign Het
Stc2 A T 11: 31,360,177 D286E probably benign Het
Stk31 T C 6: 49,437,377 Y482H probably damaging Het
Ticrr C T 7: 79,693,792 P1135L probably benign Het
Tmem55b C T 14: 50,928,894 R213Q probably damaging Het
Trim27 A T 13: 21,191,229 E310V probably benign Het
Uvrag T C 7: 98,991,981 K284R probably benign Het
Vmn1r78 A C 7: 12,153,352 S297R probably benign Het
Xylt2 A G 11: 94,669,640 S270P probably damaging Het
Zfhx3 T C 8: 108,950,178 M2620T probably benign Het
Zkscan2 C A 7: 123,499,996 probably benign Het
Zwint T C 10: 72,657,198 probably benign Het
Other mutations in Gm9833
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01951:Gm9833 APN 3 10089058 missense probably damaging 1.00
IGL03152:Gm9833 APN 3 10088274 missense probably benign 0.00
R0092:Gm9833 UTSW 3 10088573 missense possibly damaging 0.76
R0636:Gm9833 UTSW 3 10088783 missense possibly damaging 0.94
R1493:Gm9833 UTSW 3 10088884 missense probably damaging 1.00
R1697:Gm9833 UTSW 3 10089553 missense possibly damaging 0.89
R1957:Gm9833 UTSW 3 10089286 missense probably benign 0.42
R3754:Gm9833 UTSW 3 10088515 missense possibly damaging 0.95
R5658:Gm9833 UTSW 3 10088777 missense probably damaging 1.00
R5772:Gm9833 UTSW 3 10088506 missense probably damaging 1.00
R6298:Gm9833 UTSW 3 10089179 missense probably damaging 1.00
X0023:Gm9833 UTSW 3 10088316 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTTTTGAGCAGGCAATTGAAGCAG -3'
(R):5'- GCTCCTTTCCAGTATGGCTCCAATG -3'

Sequencing Primer
(F):5'- ATGGATGACAAATCTGTCCCTC -3'
(R):5'- AGTATGGCTCCAATGCCTGG -3'
Posted On2013-05-09