Mutagenetix > Incidental Mutation

Incidental Mutation 'R4416:Pds5b'

326835

Institutional Source

Beutler Lab

Gene Symbol

Pds5b

Ensembl Gene

ENSMUSG00000034021

Gene Name

PDS5 cohesin associated factor B

Synonyms

Aprin, AS3

MMRRC Submission

041137-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4416 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

150673739-150810690 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 150736396 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 275 (P275S)

Ref Sequence

ENSEMBL: ENSMUSP00000144572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016569] [ENSMUST00000038900] [ENSMUST00000202170]

AlphaFold

Q4VA53

Predicted Effect

probably damaging
Transcript: ENSMUST00000016569
AA Change: P275S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000016569
Gene: ENSMUSG00000034021
AA Change: P275S

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	244	773	6e-33	SMART
low complexity region	1156	1167	N/A	INTRINSIC
AT_hook	1247	1259	4.14e1	SMART
AT_hook	1285	1297	1.35e2	SMART
low complexity region	1307	1316	N/A	INTRINSIC
low complexity region	1318	1329	N/A	INTRINSIC
AT_hook	1370	1382	1.46e0	SMART
low complexity region	1437	1446	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000038900
AA Change: P275S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000038421
Gene: ENSMUSG00000034021
AA Change: P275S

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	244	773	6e-33	SMART
low complexity region	1156	1167	N/A	INTRINSIC
AT_hook	1249	1261	4.14e1	SMART
AT_hook	1287	1299	1.35e2	SMART
low complexity region	1309	1318	N/A	INTRINSIC
low complexity region	1320	1331	N/A	INTRINSIC
AT_hook	1373	1385	1.46e0	SMART
low complexity region	1440	1449	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000202170
AA Change: P275S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144572
Gene: ENSMUSG00000034021
AA Change: P275S

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	244	773	6e-33	SMART
low complexity region	1156	1167	N/A	INTRINSIC
AT_hook	1249	1261	4.14e1	SMART
AT_hook	1287	1299	1.35e2	SMART
low complexity region	1309	1318	N/A	INTRINSIC
low complexity region	1320	1331	N/A	INTRINSIC
AT_hook	1372	1384	1.46e0	SMART
low complexity region	1439	1448	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the conserved protein complex termed cohesin. The cohesin complex holds together sister chromatids and facilitates accurate chromosome segregation during mitosis and meiosis. This protein is also a negative regulator of cell proliferation and may be a tumor-suppressor gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality with cardiac defects, craniofacial abnormalities, axial skeletal defects, shortening of most of the long bones, abnormal enteric nervous system morphology, and decreased germ cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
4933412E24Rik	T	A	15: 60,016,423	E56V	possibly damaging	Het
Adam28	A	G	14: 68,622,082		probably null	Het
Bnc1	G	T	7: 81,968,960	H786N	probably benign	Het
Cav1	T	A	6: 17,339,249	M100K	probably benign	Het
Cdk9	A	G	2: 32,708,072	L273P	probably damaging	Het
Celsr1	A	G	15: 85,927,999	V2065A	probably damaging	Het
Cyp2c54	T	C	19: 40,038,259	Q484R	probably benign	Het
Elfn1	T	C	5: 139,972,194	S318P	possibly damaging	Het
Fam160b1	G	T	19: 57,385,397		probably null	Het
Fbxl6	T	C	15: 76,537,724	E205G	possibly damaging	Het
Frmd6	T	A	12: 70,877,249	Y94N	probably benign	Het
Gdpd1	A	T	11: 87,035,288	V277D	probably benign	Het
Gm1141	G	A	X: 71,939,619	C399Y	possibly damaging	Het
Grik1	C	A	16: 88,051,461	V140L	probably benign	Het
Grpel1	A	G	5: 36,471,272	H175R	probably damaging	Het
Gtdc1	G	T	2: 44,575,590		probably null	Het
Hivep2	A	T	10: 14,129,170	Q504L	probably benign	Het
Icos	A	T	1: 60,994,690	I160L	probably benign	Het
Igsf9b	G	T	9: 27,322,917	C442F	probably damaging	Het
Itga10	T	C	3: 96,658,246	V1062A	possibly damaging	Het
Lrp1b	C	T	2: 40,663,667	V386I	unknown	Het
Lrp2	G	T	2: 69,527,231	F409L	probably benign	Het
Nadk	T	G	4: 155,587,726	Y291*	probably null	Het
Nudt6	A	T	3: 37,405,229		probably null	Het
Oit3	T	C	10: 59,428,103	Y403C	probably damaging	Het
Olfr694	G	A	7: 106,689,011	T240I	probably benign	Het
Olfr814	T	C	10: 129,873,957	T267A	probably benign	Het
Olfr974	A	G	9: 39,942,428	H56R	probably damaging	Het
Pdzd7	T	A	19: 45,040,580	E117V	probably damaging	Het
Pik3ca	T	C	3: 32,461,530	V784A	probably damaging	Het
Polr3e	T	C	7: 120,939,057		probably null	Het
Rab3gap2	A	T	1: 185,282,347	D1231V	probably benign	Het
Rapgef2	C	A	3: 79,069,057	G1481*	probably null	Het
Rho	G	A	6: 115,935,230	V76I	probably benign	Het
Rrm1	A	G	7: 102,447,801	D96G	probably benign	Het
Slc35b2	G	A	17: 45,566,429	V161M	probably benign	Het
Srp9	A	T	1: 182,131,411	M50L	probably benign	Het
Stox1	T	C	10: 62,659,569	N975S	probably benign	Het
Sult1d1	A	G	5: 87,558,576	F169S	probably damaging	Het
Tmem63c	C	G	12: 87,081,902	T567R	probably benign	Het
Tmf1	G	T	6: 97,178,988	F12L	probably damaging	Het
Ush2a	T	C	1: 188,356,874	I342T	probably damaging	Het
Veph1	A	T	3: 66,061,185	N712K	probably damaging	Het
Vti1a	T	G	19: 55,380,948	S91A	probably benign	Het

Other mutations in Pds5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00719:Pds5b	APN	5	150722542	missense	probably benign	0.25
IGL01530:Pds5b	APN	5	150792175	missense	probably benign	0.38
IGL01812:Pds5b	APN	5	150780689	missense	probably damaging	1.00
IGL02163:Pds5b	APN	5	150756406	missense	probably benign	0.00
IGL02730:Pds5b	APN	5	150780752	splice site	probably benign
IGL02825:Pds5b	APN	5	150728970	missense	possibly damaging	0.90
IGL03143:Pds5b	APN	5	150779257	missense	probably damaging	1.00
IGL03379:Pds5b	APN	5	150788331	missense	probably damaging	1.00
PIT4283001:Pds5b	UTSW	5	150778309	missense	probably damaging	0.99
R0026:Pds5b	UTSW	5	150749830	splice site	probably benign
R0197:Pds5b	UTSW	5	150754431	missense	probably benign	0.28
R0347:Pds5b	UTSW	5	150736427	splice site	probably benign
R0396:Pds5b	UTSW	5	150779275	missense	possibly damaging	0.96
R0400:Pds5b	UTSW	5	150723353	missense	possibly damaging	0.46
R0442:Pds5b	UTSW	5	150716544	splice site	probably benign
R0745:Pds5b	UTSW	5	150805671	missense	probably benign
R0839:Pds5b	UTSW	5	150764962	missense	probably benign	0.23
R0866:Pds5b	UTSW	5	150739191	splice site	probably benign
R1247:Pds5b	UTSW	5	150775354	critical splice acceptor site	probably benign
R1330:Pds5b	UTSW	5	150761077	missense	probably damaging	0.97
R1440:Pds5b	UTSW	5	150754417	missense	probably damaging	1.00
R1526:Pds5b	UTSW	5	150716400	splice site	probably null
R2010:Pds5b	UTSW	5	150775354	critical splice acceptor site	probably benign
R2051:Pds5b	UTSW	5	150748190	missense	probably damaging	1.00
R2507:Pds5b	UTSW	5	150756428	missense	possibly damaging	0.90
R3111:Pds5b	UTSW	5	150719907	missense	probably damaging	1.00
R3820:Pds5b	UTSW	5	150736337	missense	possibly damaging	0.94
R3911:Pds5b	UTSW	5	150746706	missense	probably benign	0.41
R4077:Pds5b	UTSW	5	150794359	missense	possibly damaging	0.62
R4118:Pds5b	UTSW	5	150775354	critical splice acceptor site	probably benign
R4342:Pds5b	UTSW	5	150800854	missense	probably benign	0.17
R4503:Pds5b	UTSW	5	150728934	missense	probably damaging	1.00
R4524:Pds5b	UTSW	5	150788316	missense	probably damaging	1.00
R4579:Pds5b	UTSW	5	150746732	missense	probably damaging	0.98
R4623:Pds5b	UTSW	5	150800601	missense	probably benign	0.37
R4847:Pds5b	UTSW	5	150748112	missense	probably damaging	1.00
R4885:Pds5b	UTSW	5	150716462	missense	probably benign	0.21
R5271:Pds5b	UTSW	5	150723353	missense	possibly damaging	0.46
R5281:Pds5b	UTSW	5	150746608	missense	probably benign	0.26
R5337:Pds5b	UTSW	5	150793597	missense	probably benign	0.03
R5635:Pds5b	UTSW	5	150778221	missense	possibly damaging	0.78
R5677:Pds5b	UTSW	5	150716461	missense	possibly damaging	0.91
R6005:Pds5b	UTSW	5	150769776	splice site	probably null
R6139:Pds5b	UTSW	5	150800777	missense	possibly damaging	0.81
R6225:Pds5b	UTSW	5	150746618	missense	probably damaging	0.98
R6279:Pds5b	UTSW	5	150723248	missense	possibly damaging	0.80
R6300:Pds5b	UTSW	5	150723248	missense	possibly damaging	0.80
R6666:Pds5b	UTSW	5	150778166	missense	probably damaging	1.00
R6805:Pds5b	UTSW	5	150805561	splice site	probably null
R7038:Pds5b	UTSW	5	150800760	missense	probably benign	0.02
R7046:Pds5b	UTSW	5	150749920	missense	probably damaging	1.00
R7051:Pds5b	UTSW	5	150794282	missense	possibly damaging	0.78
R7138:Pds5b	UTSW	5	150800677	nonsense	probably null
R7255:Pds5b	UTSW	5	150796667	missense	probably benign	0.33
R7467:Pds5b	UTSW	5	150736327	missense	probably damaging	0.99
R7488:Pds5b	UTSW	5	150723337	missense	probably damaging	0.97
R7512:Pds5b	UTSW	5	150788342	missense	probably damaging	1.00
R7561:Pds5b	UTSW	5	150739318	critical splice donor site	probably null
R7576:Pds5b	UTSW	5	150778261	missense	probably damaging	1.00
R7889:Pds5b	UTSW	5	150792172	missense	probably damaging	1.00
R7982:Pds5b	UTSW	5	150769941	missense	probably damaging	1.00
R8059:Pds5b	UTSW	5	150807835	missense	unknown
R8211:Pds5b	UTSW	5	150728942	missense	possibly damaging	0.90
R8412:Pds5b	UTSW	5	150719959	missense	probably damaging	1.00
R8503:Pds5b	UTSW	5	150716507	missense	possibly damaging	0.95
R8556:Pds5b	UTSW	5	150792608	missense	probably benign
R8786:Pds5b	UTSW	5	150780669	missense	probably damaging	1.00
R8929:Pds5b	UTSW	5	150719914	missense	probably damaging	1.00
R8985:Pds5b	UTSW	5	150800774	missense	probably benign	0.38
R9184:Pds5b	UTSW	5	150800784	missense	probably benign	0.04
R9343:Pds5b	UTSW	5	150780721	missense	probably damaging	1.00
R9432:Pds5b	UTSW	5	150769791	missense	probably damaging	1.00
R9571:Pds5b	UTSW	5	150722506	missense	probably damaging	1.00
R9712:Pds5b	UTSW	5	150805663	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- CAGATGGAAAATGTTTCTGTGTTGC -3'
(R):5'- TTGGTAGGTATCTCTCCAAGCAC -3'

Sequencing Primer
(F):5'- AAATGTTTCTGTGTTGCTTGTTTGAC -3'
(R):5'- CACGAGAGACCCAGAGATAGGC -3'

Posted On

2015-07-07