Incidental Mutation 'R4416:Cav1'
ID326836
Institutional Source Beutler Lab
Gene Symbol Cav1
Ensembl Gene ENSMUSG00000007655
Gene Namecaveolin 1, caveolae protein
Synonymscaveolin-1, Cav-1
MMRRC Submission 041137-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.460) question?
Stock #R4416 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location17306335-17341452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17339249 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 100 (M100K)
Ref Sequence ENSEMBL: ENSMUSP00000111115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007799] [ENSMUST00000115453] [ENSMUST00000115454] [ENSMUST00000115455] [ENSMUST00000115456] [ENSMUST00000123439] [ENSMUST00000177234]
Predicted Effect probably benign
Transcript: ENSMUST00000007799
AA Change: M111K

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000007799
Gene: ENSMUSG00000007655
AA Change: M111K

DomainStartEndE-ValueType
Pfam:Caveolin 27 177 4.1e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115453
AA Change: M80K

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111113
Gene: ENSMUSG00000007655
AA Change: M80K

DomainStartEndE-ValueType
Pfam:Caveolin 1 146 2e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115454
AA Change: M80K

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111114
Gene: ENSMUSG00000007655
AA Change: M80K

DomainStartEndE-ValueType
Pfam:Caveolin 1 146 2e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115455
AA Change: M100K

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111115
Gene: ENSMUSG00000007655
AA Change: M100K

DomainStartEndE-ValueType
Pfam:Caveolin 16 115 2.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115456
AA Change: M111K

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111116
Gene: ENSMUSG00000007655
AA Change: M111K

DomainStartEndE-ValueType
Pfam:Caveolin 42 175 1.1e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131334
Predicted Effect probably benign
Transcript: ENSMUST00000177234
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The scaffolding protein encoded by this gene is the main component of the caveolae plasma membranes found in most cell types. The protein links integrin subunits to the tyrosine kinase FYN, an initiating step in coupling integrins to the Ras-ERK pathway and promoting cell cycle progression. The gene is a tumor suppressor gene candidate and a negative regulator of the Ras-p42/44 mitogen-activated kinase cascade. Caveolin 1 and caveolin 2 are located next to each other on chromosome 7 and express colocalizing proteins that form a stable hetero-oligomeric complex. Mutations in this gene have been associated with Berardinelli-Seip congenital lipodystrophy. Alternatively spliced transcripts encode alpha and beta isoforms of caveolin 1.[provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous targeted mutants displayed vascular system dysfunctions and thickening of lung aveloar septa from hyperproliferation and fibrosis, ultimately causing the mice physical limitations. Mice also display increased incidence of calcium calculi, kidney stones, and decreased adiposity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4933412E24Rik T A 15: 60,016,423 E56V possibly damaging Het
Adam28 A G 14: 68,622,082 probably null Het
Bnc1 G T 7: 81,968,960 H786N probably benign Het
Cdk9 A G 2: 32,708,072 L273P probably damaging Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cyp2c54 T C 19: 40,038,259 Q484R probably benign Het
Elfn1 T C 5: 139,972,194 S318P possibly damaging Het
Fam160b1 G T 19: 57,385,397 probably null Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Frmd6 T A 12: 70,877,249 Y94N probably benign Het
Gdpd1 A T 11: 87,035,288 V277D probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Grik1 C A 16: 88,051,461 V140L probably benign Het
Grpel1 A G 5: 36,471,272 H175R probably damaging Het
Gtdc1 G T 2: 44,575,590 probably null Het
Hivep2 A T 10: 14,129,170 Q504L probably benign Het
Icos A T 1: 60,994,690 I160L probably benign Het
Igsf9b G T 9: 27,322,917 C442F probably damaging Het
Itga10 T C 3: 96,658,246 V1062A possibly damaging Het
Lrp1b C T 2: 40,663,667 V386I unknown Het
Lrp2 G T 2: 69,527,231 F409L probably benign Het
Nadk T G 4: 155,587,726 Y291* probably null Het
Nudt6 A T 3: 37,405,229 probably null Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr694 G A 7: 106,689,011 T240I probably benign Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Olfr974 A G 9: 39,942,428 H56R probably damaging Het
Pds5b C T 5: 150,736,396 P275S probably damaging Het
Pdzd7 T A 19: 45,040,580 E117V probably damaging Het
Pik3ca T C 3: 32,461,530 V784A probably damaging Het
Polr3e T C 7: 120,939,057 probably null Het
Rab3gap2 A T 1: 185,282,347 D1231V probably benign Het
Rapgef2 C A 3: 79,069,057 G1481* probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rrm1 A G 7: 102,447,801 D96G probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Srp9 A T 1: 182,131,411 M50L probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Sult1d1 A G 5: 87,558,576 F169S probably damaging Het
Tmem63c C G 12: 87,081,902 T567R probably benign Het
Tmf1 G T 6: 97,178,988 F12L probably damaging Het
Ush2a T C 1: 188,356,874 I342T probably damaging Het
Veph1 A T 3: 66,061,185 N712K probably damaging Het
Vti1a T G 19: 55,380,948 S91A probably benign Het
Other mutations in Cav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02159:Cav1 APN 6 17307972 missense possibly damaging 0.93
shortstop UTSW 6 17308035 missense probably damaging 0.99
R0113:Cav1 UTSW 6 17308049 missense possibly damaging 0.60
R0149:Cav1 UTSW 6 17339353 missense possibly damaging 0.46
R0361:Cav1 UTSW 6 17339353 missense possibly damaging 0.46
R1706:Cav1 UTSW 6 17339182 missense probably damaging 0.96
R1930:Cav1 UTSW 6 17339332 missense probably damaging 1.00
R1931:Cav1 UTSW 6 17339332 missense probably damaging 1.00
R2166:Cav1 UTSW 6 17339431 missense possibly damaging 0.69
R2655:Cav1 UTSW 6 17339360 missense probably damaging 1.00
R4460:Cav1 UTSW 6 17306472 missense probably damaging 0.99
R5204:Cav1 UTSW 6 17339255 missense probably damaging 1.00
R5956:Cav1 UTSW 6 17307919 missense probably damaging 1.00
R6467:Cav1 UTSW 6 17308035 missense probably damaging 0.99
R7041:Cav1 UTSW 6 17339144 missense possibly damaging 0.70
R8370:Cav1 UTSW 6 17339294 missense possibly damaging 0.88
X0026:Cav1 UTSW 6 17339162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTGGCACACAAATCTTAC -3'
(R):5'- GGATGTTGCTGAATATCTTGCC -3'

Sequencing Primer
(F):5'- GCTGGCACACAAATCTTACACATTTG -3'
(R):5'- CTTGCCAATAGCTTCAAAGAGTGG -3'
Posted On2015-07-07