Incidental Mutation 'R4416:Tmf1'
ID326837
Institutional Source Beutler Lab
Gene Symbol Tmf1
Ensembl Gene ENSMUSG00000030059
Gene NameTATA element modulatory factor 1
Synonyms7030402D04Rik, LOC232286
MMRRC Submission 041137-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R4416 (G1)
Quality Score135
Status Not validated
Chromosome6
Chromosomal Location97152997-97179122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 97178988 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 12 (F12L)
Ref Sequence ENSEMBL: ENSMUSP00000120093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095664] [ENSMUST00000124173] [ENSMUST00000164744] [ENSMUST00000204056]
Predicted Effect probably damaging
Transcript: ENSMUST00000095664
AA Change: F12L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093325
Gene: ENSMUSG00000030059
AA Change: F12L

DomainStartEndE-ValueType
low complexity region 111 122 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 194 211 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 261 276 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
coiled coil region 443 536 N/A INTRINSIC
Pfam:TMF_DNA_bd 540 613 5e-24 PFAM
low complexity region 697 715 N/A INTRINSIC
low complexity region 719 732 N/A INTRINSIC
low complexity region 803 821 N/A INTRINSIC
coiled coil region 823 894 N/A INTRINSIC
low complexity region 923 937 N/A INTRINSIC
Pfam:TMF_TATA_bd 972 1085 1.5e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124173
AA Change: F12L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120093
Gene: ENSMUSG00000030059
AA Change: F12L

DomainStartEndE-ValueType
low complexity region 111 122 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
low complexity region 194 211 N/A INTRINSIC
low complexity region 235 253 N/A INTRINSIC
low complexity region 261 276 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
coiled coil region 443 536 N/A INTRINSIC
Pfam:TMF_DNA_bd 540 613 1.4e-24 PFAM
low complexity region 697 715 N/A INTRINSIC
low complexity region 719 732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164744
SMART Domains Protein: ENSMUSP00000130954
Gene: ENSMUSG00000030061

DomainStartEndE-ValueType
Pfam:ThiF 54 199 1.5e-41 PFAM
Pfam:UBA_e1_thiolCys 202 248 8.7e-15 PFAM
Pfam:UBACT 255 321 9e-25 PFAM
E2_bind 360 448 1.02e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204056
SMART Domains Protein: ENSMUSP00000145309
Gene: ENSMUSG00000030061

DomainStartEndE-ValueType
low complexity region 5 56 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with decreased testis weight, globozoospermia, absent acrosome, asthenozoospermia, and abnormal sperm midpiece morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4933412E24Rik T A 15: 60,016,423 E56V possibly damaging Het
Adam28 A G 14: 68,622,082 probably null Het
Bnc1 G T 7: 81,968,960 H786N probably benign Het
Cav1 T A 6: 17,339,249 M100K probably benign Het
Cdk9 A G 2: 32,708,072 L273P probably damaging Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cyp2c54 T C 19: 40,038,259 Q484R probably benign Het
Elfn1 T C 5: 139,972,194 S318P possibly damaging Het
Fam160b1 G T 19: 57,385,397 probably null Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Frmd6 T A 12: 70,877,249 Y94N probably benign Het
Gdpd1 A T 11: 87,035,288 V277D probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Grik1 C A 16: 88,051,461 V140L probably benign Het
Grpel1 A G 5: 36,471,272 H175R probably damaging Het
Gtdc1 G T 2: 44,575,590 probably null Het
Hivep2 A T 10: 14,129,170 Q504L probably benign Het
Icos A T 1: 60,994,690 I160L probably benign Het
Igsf9b G T 9: 27,322,917 C442F probably damaging Het
Itga10 T C 3: 96,658,246 V1062A possibly damaging Het
Lrp1b C T 2: 40,663,667 V386I unknown Het
Lrp2 G T 2: 69,527,231 F409L probably benign Het
Nadk T G 4: 155,587,726 Y291* probably null Het
Nudt6 A T 3: 37,405,229 probably null Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr694 G A 7: 106,689,011 T240I probably benign Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Olfr974 A G 9: 39,942,428 H56R probably damaging Het
Pds5b C T 5: 150,736,396 P275S probably damaging Het
Pdzd7 T A 19: 45,040,580 E117V probably damaging Het
Pik3ca T C 3: 32,461,530 V784A probably damaging Het
Polr3e T C 7: 120,939,057 probably null Het
Rab3gap2 A T 1: 185,282,347 D1231V probably benign Het
Rapgef2 C A 3: 79,069,057 G1481* probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rrm1 A G 7: 102,447,801 D96G probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Srp9 A T 1: 182,131,411 M50L probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Sult1d1 A G 5: 87,558,576 F169S probably damaging Het
Tmem63c C G 12: 87,081,902 T567R probably benign Het
Ush2a T C 1: 188,356,874 I342T probably damaging Het
Veph1 A T 3: 66,061,185 N712K probably damaging Het
Vti1a T G 19: 55,380,948 S91A probably benign Het
Other mutations in Tmf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Tmf1 APN 6 97176494 missense probably benign 0.00
IGL00846:Tmf1 APN 6 97173316 missense possibly damaging 0.88
IGL01575:Tmf1 APN 6 97175936 missense probably damaging 1.00
IGL01922:Tmf1 APN 6 97176930 missense probably benign 0.00
IGL02550:Tmf1 APN 6 97158561 missense probably benign 0.28
IGL02675:Tmf1 APN 6 97164042 splice site probably benign
IGL02985:Tmf1 APN 6 97176809 missense probably damaging 1.00
IGL03324:Tmf1 APN 6 97163653 missense probably damaging 0.99
caddy UTSW 6 97161447 nonsense probably null
R0028:Tmf1 UTSW 6 97158098 missense probably damaging 1.00
R0153:Tmf1 UTSW 6 97170384 missense probably damaging 0.97
R0325:Tmf1 UTSW 6 97176504 missense possibly damaging 0.51
R0420:Tmf1 UTSW 6 97176141 missense probably damaging 1.00
R0730:Tmf1 UTSW 6 97176492 missense probably benign
R0825:Tmf1 UTSW 6 97175995 missense probably benign
R0827:Tmf1 UTSW 6 97158050 nonsense probably null
R0839:Tmf1 UTSW 6 97176323 missense probably damaging 1.00
R1078:Tmf1 UTSW 6 97173300 missense probably damaging 1.00
R1905:Tmf1 UTSW 6 97161479 missense possibly damaging 0.53
R2274:Tmf1 UTSW 6 97163586 missense probably damaging 1.00
R3701:Tmf1 UTSW 6 97172331 missense possibly damaging 0.51
R3953:Tmf1 UTSW 6 97176206 missense probably damaging 0.99
R3955:Tmf1 UTSW 6 97176206 missense probably damaging 0.99
R4398:Tmf1 UTSW 6 97178896 missense probably damaging 0.99
R4497:Tmf1 UTSW 6 97172332 missense probably benign 0.00
R4592:Tmf1 UTSW 6 97173400 missense probably benign 0.00
R4669:Tmf1 UTSW 6 97170427 missense probably benign 0.00
R5214:Tmf1 UTSW 6 97167292 missense possibly damaging 0.81
R5352:Tmf1 UTSW 6 97176809 missense probably damaging 1.00
R5530:Tmf1 UTSW 6 97158087 missense probably damaging 1.00
R5815:Tmf1 UTSW 6 97173403 missense probably benign 0.28
R6806:Tmf1 UTSW 6 97161447 nonsense probably null
R6837:Tmf1 UTSW 6 97176581 missense possibly damaging 0.76
R6853:Tmf1 UTSW 6 97168849 missense probably damaging 0.99
R6887:Tmf1 UTSW 6 97176838 missense probably damaging 1.00
R7058:Tmf1 UTSW 6 97156950 missense probably damaging 1.00
R7145:Tmf1 UTSW 6 97176118 missense probably damaging 1.00
R7340:Tmf1 UTSW 6 97168100 missense possibly damaging 0.81
R7573:Tmf1 UTSW 6 97158494 missense probably benign 0.14
R7809:Tmf1 UTSW 6 97161459 missense probably damaging 0.99
R7833:Tmf1 UTSW 6 97161411 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GAAGACGCCTAGCAATTGGG -3'
(R):5'- GTTGAGAACGGCCATGAAGC -3'

Sequencing Primer
(F):5'- ACGCCTAGCAATTGGGGATCTG -3'
(R):5'- TGGTAACTAAGGGCTCCGCTC -3'
Posted On2015-07-07