Mutagenetix > Incidental Mutation

Incidental Mutation 'R4416:Tmf1'

326837

Institutional Source

Beutler Lab

Gene Symbol

Tmf1

Ensembl Gene

ENSMUSG00000030059

Gene Name

TATA element modulatory factor 1

Synonyms

7030402D04Rik, LOC232286

MMRRC Submission

041137-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.209) question?

Stock #

R4416 (G1)

Quality Score

135

Status

Not validated

Chromosome

Chromosomal Location

97152997-97179122 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 97178988 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 12 (F12L)

Ref Sequence

ENSEMBL: ENSMUSP00000120093 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095664] [ENSMUST00000124173] [ENSMUST00000164744] [ENSMUST00000204056]

AlphaFold

B9EKI3

Predicted Effect

probably damaging
Transcript: ENSMUST00000095664
AA Change: F12L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000093325
Gene: ENSMUSG00000030059
AA Change: F12L

Domain	Start	End	E-Value	Type
low complexity region	111	122	N/A	INTRINSIC
low complexity region	131	142	N/A	INTRINSIC
low complexity region	194	211	N/A	INTRINSIC
low complexity region	235	253	N/A	INTRINSIC
low complexity region	261	276	N/A	INTRINSIC
low complexity region	367	381	N/A	INTRINSIC
low complexity region	410	426	N/A	INTRINSIC
coiled coil region	443	536	N/A	INTRINSIC
Pfam:TMF_DNA_bd	540	613	5e-24	PFAM
low complexity region	697	715	N/A	INTRINSIC
low complexity region	719	732	N/A	INTRINSIC
low complexity region	803	821	N/A	INTRINSIC
coiled coil region	823	894	N/A	INTRINSIC
low complexity region	923	937	N/A	INTRINSIC
Pfam:TMF_TATA_bd	972	1085	1.5e-35	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000124173
AA Change: F12L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000120093
Gene: ENSMUSG00000030059
AA Change: F12L

Domain	Start	End	E-Value	Type
low complexity region	111	122	N/A	INTRINSIC
low complexity region	131	142	N/A	INTRINSIC
low complexity region	194	211	N/A	INTRINSIC
low complexity region	235	253	N/A	INTRINSIC
low complexity region	261	276	N/A	INTRINSIC
low complexity region	367	381	N/A	INTRINSIC
low complexity region	410	426	N/A	INTRINSIC
coiled coil region	443	536	N/A	INTRINSIC
Pfam:TMF_DNA_bd	540	613	1.4e-24	PFAM
low complexity region	697	715	N/A	INTRINSIC
low complexity region	719	732	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164744

SMART Domains

Protein: ENSMUSP00000130954
Gene: ENSMUSG00000030061

Domain	Start	End	E-Value	Type
Pfam:ThiF	54	199	1.5e-41	PFAM
Pfam:UBA_e1_thiolCys	202	248	8.7e-15	PFAM
Pfam:UBACT	255	321	9e-25	PFAM
E2_bind	360	448	1.02e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000204056

SMART Domains

Protein: ENSMUSP00000145309
Gene: ENSMUSG00000030061

Domain	Start	End	E-Value	Type
low complexity region	5	56	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with decreased testis weight, globozoospermia, absent acrosome, asthenozoospermia, and abnormal sperm midpiece morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
4933412E24Rik	T	A	15: 60,016,423	E56V	possibly damaging	Het
Adam28	A	G	14: 68,622,082		probably null	Het
Bnc1	G	T	7: 81,968,960	H786N	probably benign	Het
Cav1	T	A	6: 17,339,249	M100K	probably benign	Het
Cdk9	A	G	2: 32,708,072	L273P	probably damaging	Het
Celsr1	A	G	15: 85,927,999	V2065A	probably damaging	Het
Cyp2c54	T	C	19: 40,038,259	Q484R	probably benign	Het
Elfn1	T	C	5: 139,972,194	S318P	possibly damaging	Het
Fam160b1	G	T	19: 57,385,397		probably null	Het
Fbxl6	T	C	15: 76,537,724	E205G	possibly damaging	Het
Frmd6	T	A	12: 70,877,249	Y94N	probably benign	Het
Gdpd1	A	T	11: 87,035,288	V277D	probably benign	Het
Gm1141	G	A	X: 71,939,619	C399Y	possibly damaging	Het
Grik1	C	A	16: 88,051,461	V140L	probably benign	Het
Grpel1	A	G	5: 36,471,272	H175R	probably damaging	Het
Gtdc1	G	T	2: 44,575,590		probably null	Het
Hivep2	A	T	10: 14,129,170	Q504L	probably benign	Het
Icos	A	T	1: 60,994,690	I160L	probably benign	Het
Igsf9b	G	T	9: 27,322,917	C442F	probably damaging	Het
Itga10	T	C	3: 96,658,246	V1062A	possibly damaging	Het
Lrp1b	C	T	2: 40,663,667	V386I	unknown	Het
Lrp2	G	T	2: 69,527,231	F409L	probably benign	Het
Nadk	T	G	4: 155,587,726	Y291*	probably null	Het
Nudt6	A	T	3: 37,405,229		probably null	Het
Oit3	T	C	10: 59,428,103	Y403C	probably damaging	Het
Olfr694	G	A	7: 106,689,011	T240I	probably benign	Het
Olfr814	T	C	10: 129,873,957	T267A	probably benign	Het
Olfr974	A	G	9: 39,942,428	H56R	probably damaging	Het
Pds5b	C	T	5: 150,736,396	P275S	probably damaging	Het
Pdzd7	T	A	19: 45,040,580	E117V	probably damaging	Het
Pik3ca	T	C	3: 32,461,530	V784A	probably damaging	Het
Polr3e	T	C	7: 120,939,057		probably null	Het
Rab3gap2	A	T	1: 185,282,347	D1231V	probably benign	Het
Rapgef2	C	A	3: 79,069,057	G1481*	probably null	Het
Rho	G	A	6: 115,935,230	V76I	probably benign	Het
Rrm1	A	G	7: 102,447,801	D96G	probably benign	Het
Slc35b2	G	A	17: 45,566,429	V161M	probably benign	Het
Srp9	A	T	1: 182,131,411	M50L	probably benign	Het
Stox1	T	C	10: 62,659,569	N975S	probably benign	Het
Sult1d1	A	G	5: 87,558,576	F169S	probably damaging	Het
Tmem63c	C	G	12: 87,081,902	T567R	probably benign	Het
Ush2a	T	C	1: 188,356,874	I342T	probably damaging	Het
Veph1	A	T	3: 66,061,185	N712K	probably damaging	Het
Vti1a	T	G	19: 55,380,948	S91A	probably benign	Het

Other mutations in Tmf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00661:Tmf1	APN	6	97176494	missense	probably benign	0.00
IGL00846:Tmf1	APN	6	97173316	missense	possibly damaging	0.88
IGL01575:Tmf1	APN	6	97175936	missense	probably damaging	1.00
IGL01922:Tmf1	APN	6	97176930	missense	probably benign	0.00
IGL02550:Tmf1	APN	6	97158561	missense	probably benign	0.28
IGL02675:Tmf1	APN	6	97164042	splice site	probably benign
IGL02985:Tmf1	APN	6	97176809	missense	probably damaging	1.00
IGL03324:Tmf1	APN	6	97163653	missense	probably damaging	0.99
caddy	UTSW	6	97161447	nonsense	probably null
R0028:Tmf1	UTSW	6	97158098	missense	probably damaging	1.00
R0153:Tmf1	UTSW	6	97170384	missense	probably damaging	0.97
R0325:Tmf1	UTSW	6	97176504	missense	possibly damaging	0.51
R0420:Tmf1	UTSW	6	97176141	missense	probably damaging	1.00
R0730:Tmf1	UTSW	6	97176492	missense	probably benign
R0825:Tmf1	UTSW	6	97175995	missense	probably benign
R0827:Tmf1	UTSW	6	97158050	nonsense	probably null
R0839:Tmf1	UTSW	6	97176323	missense	probably damaging	1.00
R1078:Tmf1	UTSW	6	97173300	missense	probably damaging	1.00
R1905:Tmf1	UTSW	6	97161479	missense	possibly damaging	0.53
R2274:Tmf1	UTSW	6	97163586	missense	probably damaging	1.00
R3701:Tmf1	UTSW	6	97172331	missense	possibly damaging	0.51
R3953:Tmf1	UTSW	6	97176206	missense	probably damaging	0.99
R3955:Tmf1	UTSW	6	97176206	missense	probably damaging	0.99
R4398:Tmf1	UTSW	6	97178896	missense	probably damaging	0.99
R4497:Tmf1	UTSW	6	97172332	missense	probably benign	0.00
R4592:Tmf1	UTSW	6	97173400	missense	probably benign	0.00
R4669:Tmf1	UTSW	6	97170427	missense	probably benign	0.00
R5214:Tmf1	UTSW	6	97167292	missense	possibly damaging	0.81
R5352:Tmf1	UTSW	6	97176809	missense	probably damaging	1.00
R5530:Tmf1	UTSW	6	97158087	missense	probably damaging	1.00
R5815:Tmf1	UTSW	6	97173403	missense	probably benign	0.28
R6806:Tmf1	UTSW	6	97161447	nonsense	probably null
R6837:Tmf1	UTSW	6	97176581	missense	possibly damaging	0.76
R6853:Tmf1	UTSW	6	97168849	missense	probably damaging	0.99
R6887:Tmf1	UTSW	6	97176838	missense	probably damaging	1.00
R7058:Tmf1	UTSW	6	97156950	missense	probably damaging	1.00
R7145:Tmf1	UTSW	6	97176118	missense	probably damaging	1.00
R7340:Tmf1	UTSW	6	97168100	missense	possibly damaging	0.81
R7573:Tmf1	UTSW	6	97158494	missense	probably benign	0.14
R7809:Tmf1	UTSW	6	97161459	missense	probably damaging	0.99
R7833:Tmf1	UTSW	6	97161411	missense	probably benign	0.06
R8728:Tmf1	UTSW	6	97156860	missense	probably damaging	1.00
R9004:Tmf1	UTSW	6	97175777	missense	probably benign	0.14
R9425:Tmf1	UTSW	6	97172332	missense	probably benign	0.00
R9436:Tmf1	UTSW	6	97176656	missense	probably benign	0.05
R9454:Tmf1	UTSW	6	97178905	missense	probably benign	0.00
R9458:Tmf1	UTSW	6	97176421	missense	probably benign	0.00
R9490:Tmf1	UTSW	6	97160266	missense	probably benign	0.00
R9544:Tmf1	UTSW	6	97170332	missense	possibly damaging	0.92
R9558:Tmf1	UTSW	6	97170332	missense	possibly damaging	0.92
R9560:Tmf1	UTSW	6	97170332	missense	possibly damaging	0.92
R9595:Tmf1	UTSW	6	97158496	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAAGACGCCTAGCAATTGGG -3'
(R):5'- GTTGAGAACGGCCATGAAGC -3'

Sequencing Primer
(F):5'- ACGCCTAGCAATTGGGGATCTG -3'
(R):5'- TGGTAACTAAGGGCTCCGCTC -3'

Posted On

2015-07-07