Mutagenetix > Incidental Mutation

Incidental Mutation 'R4416:Rho'

326838

Institutional Source

Beutler Lab

Gene Symbol

Rho

Ensembl Gene

ENSMUSG00000030324

Gene Name

rhodopsin

Synonyms

Noerg1, Ops, RP4, Long Wavelength Sensitive opsin, opsin 2, L opsin, LWS opsin, Red Opsin, Opn2, Rod Opsin

MMRRC Submission

041137-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R4416 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115931748-115940036 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 115935230 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 76 (V76I)

Ref Sequence

ENSEMBL: ENSMUSP00000144768 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032471] [ENSMUST00000203877] [ENSMUST00000204493] [ENSMUST00000204711]

AlphaFold

P15409

Predicted Effect

probably benign
Transcript: ENSMUST00000032471
AA Change: V218I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000032471
Gene: ENSMUSG00000030324
AA Change: V218I

Domain	Start	End	E-Value	Type
Pfam:Rhodopsin_N	2	37	1e-23	PFAM
Pfam:7TM_GPCR_Srv	40	323	1.2e-12	PFAM
Pfam:7TM_GPCR_Srw	42	324	7.9e-12	PFAM
Pfam:7TM_GPCR_Srsx	48	321	4.9e-11	PFAM
Pfam:7tm_1	54	306	5.1e-49	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203284

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203323

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203531

Predicted Effect

probably benign
Transcript: ENSMUST00000203877
AA Change: V59I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000144952
Gene: ENSMUSG00000030324
AA Change: V59I

Domain	Start	End	E-Value	Type
Pfam:7tm_1	6	147	1.6e-17	PFAM
Pfam:7TM_GPCR_Srw	19	165	1.2e-8	PFAM
Pfam:7TM_GPCR_Srsx	25	162	1.2e-4	PFAM
Pfam:7TM_GPCR_Srv	29	164	7.3e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203894

Predicted Effect

probably benign
Transcript: ENSMUST00000204493

SMART Domains

Protein: ENSMUSP00000145464
Gene: ENSMUSG00000030324

Domain	Start	End	E-Value	Type
low complexity region	20	41	N/A	INTRINSIC
low complexity region	48	54	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000204711
AA Change: V76I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000144768
Gene: ENSMUSG00000030324
AA Change: V76I

Domain	Start	End	E-Value	Type
Pfam:7tm_1	1	164	4.1e-24	PFAM
Pfam:7TM_GPCR_Srw	11	182	5.4e-9	PFAM
Pfam:7TM_GPCR_Srv	13	181	1.6e-7	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retinitis pigmentosa is an inherited progressive disease which is a major cause of blindness in western communities. It can be inherited as an autosomal dominant, autosomal recessive, or X-linked recessive disorder. In the autosomal dominant form,which comprises about 25% of total cases, approximately 30% of families have mutations in the gene encoding the rod photoreceptor-specific protein rhodopsin. This is the transmembrane protein which, when photoexcited, initiates the visual transduction cascade. Defects in this gene are also one of the causes of congenital stationary night blindness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted null homozygotes fail to develop retinal rod outer segments and lose their photoreceptors while heterozygotes exhibit some disorganization of their photoreceptors and a shortening of the outer segments with age. Some point mutants have only light-induced photoreceptor degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
4933412E24Rik	T	A	15: 60,016,423	E56V	possibly damaging	Het
Adam28	A	G	14: 68,622,082		probably null	Het
Bnc1	G	T	7: 81,968,960	H786N	probably benign	Het
Cav1	T	A	6: 17,339,249	M100K	probably benign	Het
Cdk9	A	G	2: 32,708,072	L273P	probably damaging	Het
Celsr1	A	G	15: 85,927,999	V2065A	probably damaging	Het
Cyp2c54	T	C	19: 40,038,259	Q484R	probably benign	Het
Elfn1	T	C	5: 139,972,194	S318P	possibly damaging	Het
Fam160b1	G	T	19: 57,385,397		probably null	Het
Fbxl6	T	C	15: 76,537,724	E205G	possibly damaging	Het
Frmd6	T	A	12: 70,877,249	Y94N	probably benign	Het
Gdpd1	A	T	11: 87,035,288	V277D	probably benign	Het
Gm1141	G	A	X: 71,939,619	C399Y	possibly damaging	Het
Grik1	C	A	16: 88,051,461	V140L	probably benign	Het
Grpel1	A	G	5: 36,471,272	H175R	probably damaging	Het
Gtdc1	G	T	2: 44,575,590		probably null	Het
Hivep2	A	T	10: 14,129,170	Q504L	probably benign	Het
Icos	A	T	1: 60,994,690	I160L	probably benign	Het
Igsf9b	G	T	9: 27,322,917	C442F	probably damaging	Het
Itga10	T	C	3: 96,658,246	V1062A	possibly damaging	Het
Lrp1b	C	T	2: 40,663,667	V386I	unknown	Het
Lrp2	G	T	2: 69,527,231	F409L	probably benign	Het
Nadk	T	G	4: 155,587,726	Y291*	probably null	Het
Nudt6	A	T	3: 37,405,229		probably null	Het
Oit3	T	C	10: 59,428,103	Y403C	probably damaging	Het
Olfr694	G	A	7: 106,689,011	T240I	probably benign	Het
Olfr814	T	C	10: 129,873,957	T267A	probably benign	Het
Olfr974	A	G	9: 39,942,428	H56R	probably damaging	Het
Pds5b	C	T	5: 150,736,396	P275S	probably damaging	Het
Pdzd7	T	A	19: 45,040,580	E117V	probably damaging	Het
Pik3ca	T	C	3: 32,461,530	V784A	probably damaging	Het
Polr3e	T	C	7: 120,939,057		probably null	Het
Rab3gap2	A	T	1: 185,282,347	D1231V	probably benign	Het
Rapgef2	C	A	3: 79,069,057	G1481*	probably null	Het
Rrm1	A	G	7: 102,447,801	D96G	probably benign	Het
Slc35b2	G	A	17: 45,566,429	V161M	probably benign	Het
Srp9	A	T	1: 182,131,411	M50L	probably benign	Het
Stox1	T	C	10: 62,659,569	N975S	probably benign	Het
Sult1d1	A	G	5: 87,558,576	F169S	probably damaging	Het
Tmem63c	C	G	12: 87,081,902	T567R	probably benign	Het
Tmf1	G	T	6: 97,178,988	F12L	probably damaging	Het
Ush2a	T	C	1: 188,356,874	I342T	probably damaging	Het
Veph1	A	T	3: 66,061,185	N712K	probably damaging	Het
Vti1a	T	G	19: 55,380,948	S91A	probably benign	Het

Other mutations in Rho

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02432:Rho	APN	6	115932185	missense	probably damaging	0.99
IGL02480:Rho	APN	6	115935544	missense	probably benign	0.20
IGL02625:Rho	APN	6	115935197	missense	possibly damaging	0.95
bemr3	UTSW	6	115935131	missense	probably damaging	1.00
R0165:Rho	UTSW	6	115932227	missense	probably damaging	1.00
R1167:Rho	UTSW	6	115935423	missense	probably damaging	0.98
R1169:Rho	UTSW	6	115932238	missense	probably damaging	1.00
R1312:Rho	UTSW	6	115935605	missense	probably damaging	1.00
R2393:Rho	UTSW	6	115935391	splice site	probably benign
R3895:Rho	UTSW	6	115933902	missense	probably damaging	1.00
R4414:Rho	UTSW	6	115935230	missense	probably benign
R5753:Rho	UTSW	6	115935487	missense	probably damaging	1.00
R6483:Rho	UTSW	6	115932257	missense	possibly damaging	0.78
R6552:Rho	UTSW	6	115931748	splice site	probably null
R6719:Rho	UTSW	6	115933893	missense	possibly damaging	0.58
R7030:Rho	UTSW	6	115935543	missense	possibly damaging	0.93
R7354:Rho	UTSW	6	115935503	nonsense	probably null
R7566:Rho	UTSW	6	115932174	missense	probably damaging	1.00
R7674:Rho	UTSW	6	115932333	missense	probably damaging	1.00
R7699:Rho	UTSW	6	115935239	missense	probably damaging	0.98
R7700:Rho	UTSW	6	115935239	missense	probably damaging	0.98
R8477:Rho	UTSW	6	115935385	splice site	probably null
R8745:Rho	UTSW	6	115935522	missense	probably damaging	1.00
R9783:Rho	UTSW	6	115933959	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AAAGCCATTCATGCTTATGTCCAG -3'
(R):5'- ATGCGGGTGACTTCCTTCTC -3'

Sequencing Primer
(F):5'- CATGCTTATGTCCAGCTGGGC -3'
(R):5'- CTGAGTGGTGGCTGACTCC -3'

Posted On

2015-07-07