Incidental Mutation 'R4416:Rho'
ID326838
Institutional Source Beutler Lab
Gene Symbol Rho
Ensembl Gene ENSMUSG00000030324
Gene Namerhodopsin
SynonymsNoerg1, Ops, RP4, Long Wavelength Sensitive opsin, opsin 2, L opsin, LWS opsin, Red Opsin, Opn2, Rod Opsin
MMRRC Submission 041137-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R4416 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location115931748-115940036 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115935230 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 76 (V76I)
Ref Sequence ENSEMBL: ENSMUSP00000144768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032471] [ENSMUST00000203877] [ENSMUST00000204493] [ENSMUST00000204711]
Predicted Effect probably benign
Transcript: ENSMUST00000032471
AA Change: V218I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032471
Gene: ENSMUSG00000030324
AA Change: V218I

DomainStartEndE-ValueType
Pfam:Rhodopsin_N 2 37 1e-23 PFAM
Pfam:7TM_GPCR_Srv 40 323 1.2e-12 PFAM
Pfam:7TM_GPCR_Srw 42 324 7.9e-12 PFAM
Pfam:7TM_GPCR_Srsx 48 321 4.9e-11 PFAM
Pfam:7tm_1 54 306 5.1e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203531
Predicted Effect probably benign
Transcript: ENSMUST00000203877
AA Change: V59I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144952
Gene: ENSMUSG00000030324
AA Change: V59I

DomainStartEndE-ValueType
Pfam:7tm_1 6 147 1.6e-17 PFAM
Pfam:7TM_GPCR_Srw 19 165 1.2e-8 PFAM
Pfam:7TM_GPCR_Srsx 25 162 1.2e-4 PFAM
Pfam:7TM_GPCR_Srv 29 164 7.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203894
Predicted Effect probably benign
Transcript: ENSMUST00000204493
SMART Domains Protein: ENSMUSP00000145464
Gene: ENSMUSG00000030324

DomainStartEndE-ValueType
low complexity region 20 41 N/A INTRINSIC
low complexity region 48 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204711
AA Change: V76I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144768
Gene: ENSMUSG00000030324
AA Change: V76I

DomainStartEndE-ValueType
Pfam:7tm_1 1 164 4.1e-24 PFAM
Pfam:7TM_GPCR_Srw 11 182 5.4e-9 PFAM
Pfam:7TM_GPCR_Srv 13 181 1.6e-7 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retinitis pigmentosa is an inherited progressive disease which is a major cause of blindness in western communities. It can be inherited as an autosomal dominant, autosomal recessive, or X-linked recessive disorder. In the autosomal dominant form,which comprises about 25% of total cases, approximately 30% of families have mutations in the gene encoding the rod photoreceptor-specific protein rhodopsin. This is the transmembrane protein which, when photoexcited, initiates the visual transduction cascade. Defects in this gene are also one of the causes of congenital stationary night blindness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted null homozygotes fail to develop retinal rod outer segments and lose their photoreceptors while heterozygotes exhibit some disorganization of their photoreceptors and a shortening of the outer segments with age. Some point mutants have only light-induced photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4933412E24Rik T A 15: 60,016,423 E56V possibly damaging Het
Adam28 A G 14: 68,622,082 probably null Het
Bnc1 G T 7: 81,968,960 H786N probably benign Het
Cav1 T A 6: 17,339,249 M100K probably benign Het
Cdk9 A G 2: 32,708,072 L273P probably damaging Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cyp2c54 T C 19: 40,038,259 Q484R probably benign Het
Elfn1 T C 5: 139,972,194 S318P possibly damaging Het
Fam160b1 G T 19: 57,385,397 probably null Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Frmd6 T A 12: 70,877,249 Y94N probably benign Het
Gdpd1 A T 11: 87,035,288 V277D probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Grik1 C A 16: 88,051,461 V140L probably benign Het
Grpel1 A G 5: 36,471,272 H175R probably damaging Het
Gtdc1 G T 2: 44,575,590 probably null Het
Hivep2 A T 10: 14,129,170 Q504L probably benign Het
Icos A T 1: 60,994,690 I160L probably benign Het
Igsf9b G T 9: 27,322,917 C442F probably damaging Het
Itga10 T C 3: 96,658,246 V1062A possibly damaging Het
Lrp1b C T 2: 40,663,667 V386I unknown Het
Lrp2 G T 2: 69,527,231 F409L probably benign Het
Nadk T G 4: 155,587,726 Y291* probably null Het
Nudt6 A T 3: 37,405,229 probably null Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr694 G A 7: 106,689,011 T240I probably benign Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Olfr974 A G 9: 39,942,428 H56R probably damaging Het
Pds5b C T 5: 150,736,396 P275S probably damaging Het
Pdzd7 T A 19: 45,040,580 E117V probably damaging Het
Pik3ca T C 3: 32,461,530 V784A probably damaging Het
Polr3e T C 7: 120,939,057 probably null Het
Rab3gap2 A T 1: 185,282,347 D1231V probably benign Het
Rapgef2 C A 3: 79,069,057 G1481* probably null Het
Rrm1 A G 7: 102,447,801 D96G probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Srp9 A T 1: 182,131,411 M50L probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Sult1d1 A G 5: 87,558,576 F169S probably damaging Het
Tmem63c C G 12: 87,081,902 T567R probably benign Het
Tmf1 G T 6: 97,178,988 F12L probably damaging Het
Ush2a T C 1: 188,356,874 I342T probably damaging Het
Veph1 A T 3: 66,061,185 N712K probably damaging Het
Vti1a T G 19: 55,380,948 S91A probably benign Het
Other mutations in Rho
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Rho APN 6 115932185 missense probably damaging 0.99
IGL02480:Rho APN 6 115935544 missense probably benign 0.20
IGL02625:Rho APN 6 115935197 missense possibly damaging 0.95
bemr3 UTSW 6 115935131 missense probably damaging 1.00
R0165:Rho UTSW 6 115932227 missense probably damaging 1.00
R1167:Rho UTSW 6 115935423 missense probably damaging 0.98
R1169:Rho UTSW 6 115932238 missense probably damaging 1.00
R1312:Rho UTSW 6 115935605 missense probably damaging 1.00
R2393:Rho UTSW 6 115935391 splice site probably benign
R3895:Rho UTSW 6 115933902 missense probably damaging 1.00
R4414:Rho UTSW 6 115935230 missense probably benign
R5753:Rho UTSW 6 115935487 missense probably damaging 1.00
R6483:Rho UTSW 6 115932257 missense possibly damaging 0.78
R6552:Rho UTSW 6 115931748 unclassified probably null
R6719:Rho UTSW 6 115933893 missense possibly damaging 0.58
R7030:Rho UTSW 6 115935543 missense possibly damaging 0.93
R7354:Rho UTSW 6 115935503 nonsense probably null
R7566:Rho UTSW 6 115932174 missense probably damaging 1.00
R7674:Rho UTSW 6 115932333 missense probably damaging 1.00
R7699:Rho UTSW 6 115935239 missense probably damaging 0.98
R7700:Rho UTSW 6 115935239 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAGCCATTCATGCTTATGTCCAG -3'
(R):5'- ATGCGGGTGACTTCCTTCTC -3'

Sequencing Primer
(F):5'- CATGCTTATGTCCAGCTGGGC -3'
(R):5'- CTGAGTGGTGGCTGACTCC -3'
Posted On2015-07-07