Mutagenetix > Incidental Mutation

Incidental Mutation 'R4416:Oit3'

326846

Institutional Source

Beutler Lab

Gene Symbol

Oit3

Ensembl Gene

ENSMUSG00000009654

Gene Name

oncoprotein induced transcript 3

Synonyms

EF-9

MMRRC Submission

041137-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.211) question?

Stock #

R4416 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59422958-59441778 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 59428103 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 403 (Y403C)

Ref Sequence

ENSEMBL: ENSMUSP00000009798 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009798]

AlphaFold

Q8R4V5

Predicted Effect

probably damaging
Transcript: ENSMUST00000009798
AA Change: Y403C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654
AA Change: Y403C

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:ZP	50	144	9e-24	BLAST
EGF	150	181	2.16e1	SMART
EGF	185	222	2.94e-3	SMART
EGF	226	263	2.35e-2	SMART
ZP	267	516	2.74e-30	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162493

Meta Mutation Damage Score

0.5154

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified due to its downregulation in hepatocarcinomas. The encoded protein may be involved in liver development and function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bloord uric acid, increased urine uric acid and polyuria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
4933412E24Rik	T	A	15: 60,016,423	E56V	possibly damaging	Het
Adam28	A	G	14: 68,622,082		probably null	Het
Bnc1	G	T	7: 81,968,960	H786N	probably benign	Het
Cav1	T	A	6: 17,339,249	M100K	probably benign	Het
Cdk9	A	G	2: 32,708,072	L273P	probably damaging	Het
Celsr1	A	G	15: 85,927,999	V2065A	probably damaging	Het
Cyp2c54	T	C	19: 40,038,259	Q484R	probably benign	Het
Elfn1	T	C	5: 139,972,194	S318P	possibly damaging	Het
Fam160b1	G	T	19: 57,385,397		probably null	Het
Fbxl6	T	C	15: 76,537,724	E205G	possibly damaging	Het
Frmd6	T	A	12: 70,877,249	Y94N	probably benign	Het
Gdpd1	A	T	11: 87,035,288	V277D	probably benign	Het
Gm1141	G	A	X: 71,939,619	C399Y	possibly damaging	Het
Grik1	C	A	16: 88,051,461	V140L	probably benign	Het
Grpel1	A	G	5: 36,471,272	H175R	probably damaging	Het
Gtdc1	G	T	2: 44,575,590		probably null	Het
Hivep2	A	T	10: 14,129,170	Q504L	probably benign	Het
Icos	A	T	1: 60,994,690	I160L	probably benign	Het
Igsf9b	G	T	9: 27,322,917	C442F	probably damaging	Het
Itga10	T	C	3: 96,658,246	V1062A	possibly damaging	Het
Lrp1b	C	T	2: 40,663,667	V386I	unknown	Het
Lrp2	G	T	2: 69,527,231	F409L	probably benign	Het
Nadk	T	G	4: 155,587,726	Y291*	probably null	Het
Nudt6	A	T	3: 37,405,229		probably null	Het
Olfr694	G	A	7: 106,689,011	T240I	probably benign	Het
Olfr814	T	C	10: 129,873,957	T267A	probably benign	Het
Olfr974	A	G	9: 39,942,428	H56R	probably damaging	Het
Pds5b	C	T	5: 150,736,396	P275S	probably damaging	Het
Pdzd7	T	A	19: 45,040,580	E117V	probably damaging	Het
Pik3ca	T	C	3: 32,461,530	V784A	probably damaging	Het
Polr3e	T	C	7: 120,939,057		probably null	Het
Rab3gap2	A	T	1: 185,282,347	D1231V	probably benign	Het
Rapgef2	C	A	3: 79,069,057	G1481*	probably null	Het
Rho	G	A	6: 115,935,230	V76I	probably benign	Het
Rrm1	A	G	7: 102,447,801	D96G	probably benign	Het
Slc35b2	G	A	17: 45,566,429	V161M	probably benign	Het
Srp9	A	T	1: 182,131,411	M50L	probably benign	Het
Stox1	T	C	10: 62,659,569	N975S	probably benign	Het
Sult1d1	A	G	5: 87,558,576	F169S	probably damaging	Het
Tmem63c	C	G	12: 87,081,902	T567R	probably benign	Het
Tmf1	G	T	6: 97,178,988	F12L	probably damaging	Het
Ush2a	T	C	1: 188,356,874	I342T	probably damaging	Het
Veph1	A	T	3: 66,061,185	N712K	probably damaging	Het
Vti1a	T	G	19: 55,380,948	S91A	probably benign	Het

Other mutations in Oit3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01457:Oit3	APN	10	59425484	unclassified	probably benign
IGL01665:Oit3	APN	10	59438909	missense	probably damaging	1.00
IGL01839:Oit3	APN	10	59429496	missense	probably damaging	0.98
IGL02028:Oit3	APN	10	59438655	missense	probably damaging	0.98
PIT4585001:Oit3	UTSW	10	59431013	missense	possibly damaging	0.54
R0567:Oit3	UTSW	10	59435978	missense	probably damaging	0.99
R0781:Oit3	UTSW	10	59428194	missense	probably damaging	1.00
R1110:Oit3	UTSW	10	59428194	missense	probably damaging	1.00
R1563:Oit3	UTSW	10	59428074	missense	probably damaging	1.00
R1623:Oit3	UTSW	10	59428239	missense	probably damaging	0.99
R1693:Oit3	UTSW	10	59425417	missense	probably damaging	1.00
R1754:Oit3	UTSW	10	59427940	splice site	probably null
R1853:Oit3	UTSW	10	59441622	critical splice donor site	probably null
R2070:Oit3	UTSW	10	59431013	missense	probably benign	0.03
R2211:Oit3	UTSW	10	59428070	missense	probably damaging	1.00
R2516:Oit3	UTSW	10	59428345	missense	probably damaging	1.00
R2516:Oit3	UTSW	10	59441685	start gained	probably benign
R3103:Oit3	UTSW	10	59438891	missense	probably damaging	0.98
R4414:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4415:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4417:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4584:Oit3	UTSW	10	59425462	missense	probably damaging	1.00
R4734:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R4748:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R4749:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R5070:Oit3	UTSW	10	59424027	missense	probably damaging	1.00
R5521:Oit3	UTSW	10	59435914	missense	probably benign
R6326:Oit3	UTSW	10	59428239	missense	probably damaging	1.00
R6490:Oit3	UTSW	10	59438552	missense	possibly damaging	0.92
R6526:Oit3	UTSW	10	59429640	missense	probably damaging	1.00
R6766:Oit3	UTSW	10	59438712	missense	probably damaging	0.99
R6921:Oit3	UTSW	10	59435945	missense	probably damaging	0.99
R7129:Oit3	UTSW	10	59428344	missense	probably damaging	0.99
R7440:Oit3	UTSW	10	59429570	missense	probably damaging	0.99
R7495:Oit3	UTSW	10	59423943	missense	possibly damaging	0.74
R7512:Oit3	UTSW	10	59438894	missense	probably damaging	1.00
R7866:Oit3	UTSW	10	59424030	missense	probably benign	0.03
R8312:Oit3	UTSW	10	59438810	missense	probably benign	0.01
R8321:Oit3	UTSW	10	59428160	missense	probably benign	0.00
R8919:Oit3	UTSW	10	59441646	missense	unknown
R9131:Oit3	UTSW	10	59435929	missense	probably benign	0.01
R9457:Oit3	UTSW	10	59441683	start codon destroyed	unknown
R9478:Oit3	UTSW	10	59438642	missense	probably damaging	0.99
R9502:Oit3	UTSW	10	59428351	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATTCCACAGGTGTCTCAAGTG -3'
(R):5'- CAGCAAACTGTTGATCCCCG -3'

Sequencing Primer
(F):5'- CTGTTTTACGACCAAATTCAATGG -3'
(R):5'- AAACTGTTGATCCCCGTGACCTG -3'

Posted On

2015-07-07