Incidental Mutation 'R4416:Stox1'
ID326847
Institutional Source Beutler Lab
Gene Symbol Stox1
Ensembl Gene ENSMUSG00000036923
Gene Namestorkhead box 1
Synonyms4732470K04Rik
MMRRC Submission 041137-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R4416 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62659043-62726128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62659569 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 975 (N975S)
Ref Sequence ENSEMBL: ENSMUSP00000114652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133371] [ENSMUST00000148720]
Predicted Effect probably benign
Transcript: ENSMUST00000133371
AA Change: N975S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114652
Gene: ENSMUSG00000036923
AA Change: N975S

DomainStartEndE-ValueType
low complexity region 31 71 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Pfam:Stork_head 108 186 4.4e-37 PFAM
low complexity region 416 429 N/A INTRINSIC
low complexity region 448 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148720
SMART Domains Protein: ENSMUSP00000116180
Gene: ENSMUSG00000036923

DomainStartEndE-ValueType
Pfam:Stork_head 19 98 9e-40 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may function as a DNA binding protein. Mutations in this gene are associated with pre-eclampsia/eclampsia 4 (PEE4). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4933412E24Rik T A 15: 60,016,423 E56V possibly damaging Het
Adam28 A G 14: 68,622,082 probably null Het
Bnc1 G T 7: 81,968,960 H786N probably benign Het
Cav1 T A 6: 17,339,249 M100K probably benign Het
Cdk9 A G 2: 32,708,072 L273P probably damaging Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cyp2c54 T C 19: 40,038,259 Q484R probably benign Het
Elfn1 T C 5: 139,972,194 S318P possibly damaging Het
Fam160b1 G T 19: 57,385,397 probably null Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Frmd6 T A 12: 70,877,249 Y94N probably benign Het
Gdpd1 A T 11: 87,035,288 V277D probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Grik1 C A 16: 88,051,461 V140L probably benign Het
Grpel1 A G 5: 36,471,272 H175R probably damaging Het
Gtdc1 G T 2: 44,575,590 probably null Het
Hivep2 A T 10: 14,129,170 Q504L probably benign Het
Icos A T 1: 60,994,690 I160L probably benign Het
Igsf9b G T 9: 27,322,917 C442F probably damaging Het
Itga10 T C 3: 96,658,246 V1062A possibly damaging Het
Lrp1b C T 2: 40,663,667 V386I unknown Het
Lrp2 G T 2: 69,527,231 F409L probably benign Het
Nadk T G 4: 155,587,726 Y291* probably null Het
Nudt6 A T 3: 37,405,229 probably null Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr694 G A 7: 106,689,011 T240I probably benign Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Olfr974 A G 9: 39,942,428 H56R probably damaging Het
Pds5b C T 5: 150,736,396 P275S probably damaging Het
Pdzd7 T A 19: 45,040,580 E117V probably damaging Het
Pik3ca T C 3: 32,461,530 V784A probably damaging Het
Polr3e T C 7: 120,939,057 probably null Het
Rab3gap2 A T 1: 185,282,347 D1231V probably benign Het
Rapgef2 C A 3: 79,069,057 G1481* probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rrm1 A G 7: 102,447,801 D96G probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Srp9 A T 1: 182,131,411 M50L probably benign Het
Sult1d1 A G 5: 87,558,576 F169S probably damaging Het
Tmem63c C G 12: 87,081,902 T567R probably benign Het
Tmf1 G T 6: 97,178,988 F12L probably damaging Het
Ush2a T C 1: 188,356,874 I342T probably damaging Het
Veph1 A T 3: 66,061,185 N712K probably damaging Het
Vti1a T G 19: 55,380,948 S91A probably benign Het
Other mutations in Stox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Stox1 APN 10 62667913 missense probably damaging 1.00
IGL01462:Stox1 APN 10 62664682 missense probably benign 0.14
IGL01558:Stox1 APN 10 62667872 missense probably damaging 0.98
IGL02391:Stox1 APN 10 62659676 splice site probably benign
IGL02454:Stox1 APN 10 62667826 missense probably damaging 1.00
IGL02510:Stox1 APN 10 62664047 missense probably benign 0.14
IGL02635:Stox1 APN 10 62664906 missense probably benign 0.02
R1036:Stox1 UTSW 10 62667895 missense probably damaging 1.00
R1486:Stox1 UTSW 10 62664636 missense probably benign 0.06
R1751:Stox1 UTSW 10 62659666 missense probably damaging 0.97
R1763:Stox1 UTSW 10 62667965 missense probably damaging 1.00
R1892:Stox1 UTSW 10 62665399 missense possibly damaging 0.56
R2128:Stox1 UTSW 10 62664535 missense probably benign 0.42
R2406:Stox1 UTSW 10 62664166 missense probably benign 0.01
R4078:Stox1 UTSW 10 62666031 missense probably benign 0.00
R4414:Stox1 UTSW 10 62659569 missense probably benign 0.00
R4415:Stox1 UTSW 10 62659569 missense probably benign 0.00
R4417:Stox1 UTSW 10 62659569 missense probably benign 0.00
R4799:Stox1 UTSW 10 62665737 missense probably damaging 1.00
R5261:Stox1 UTSW 10 62667841 missense probably damaging 0.98
R5323:Stox1 UTSW 10 62664033 missense possibly damaging 0.71
R5885:Stox1 UTSW 10 62664848 missense probably damaging 0.99
R6182:Stox1 UTSW 10 62664942 missense probably damaging 0.99
R7548:Stox1 UTSW 10 62666167 missense probably damaging 0.99
R7757:Stox1 UTSW 10 62663964 missense probably damaging 1.00
R7765:Stox1 UTSW 10 62665999 missense probably benign 0.26
R7846:Stox1 UTSW 10 62659526 missense probably damaging 1.00
R7867:Stox1 UTSW 10 62664944 missense probably benign 0.00
R8077:Stox1 UTSW 10 62665566 missense probably damaging 1.00
R8409:Stox1 UTSW 10 62666016 missense probably benign 0.00
R8413:Stox1 UTSW 10 62664975 missense probably damaging 1.00
R8443:Stox1 UTSW 10 62665764 missense probably damaging 1.00
RF014:Stox1 UTSW 10 62664246 missense probably benign 0.06
Z1176:Stox1 UTSW 10 62664018 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAGCTTCCAAGGACTTTCAC -3'
(R):5'- TCCTAATGGTACTGGGAGGC -3'

Sequencing Primer
(F):5'- CCAGTTTCTACAAGAGTTCTCCAAAG -3'
(R):5'- ACATGAGAATGTGTTTCTGAAGG -3'
Posted On2015-07-07