Mutagenetix > Incidental Mutation

Incidental Mutation 'R4416:Stox1'

326847

Institutional Source

Beutler Lab

Gene Symbol

Stox1

Ensembl Gene

ENSMUSG00000036923

Gene Name

storkhead box 1

Synonyms

4732470K04Rik

MMRRC Submission

041137-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.260) question?

Stock #

R4416 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62659043-62726128 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62659569 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 975 (N975S)

Ref Sequence

ENSEMBL: ENSMUSP00000114652 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000133371] [ENSMUST00000148720]

AlphaFold

B2RQL2

Predicted Effect

probably benign
Transcript: ENSMUST00000133371
AA Change: N975S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000114652
Gene: ENSMUSG00000036923
AA Change: N975S

Domain	Start	End	E-Value	Type
low complexity region	31	71	N/A	INTRINSIC
low complexity region	80	93	N/A	INTRINSIC
Pfam:Stork_head	108	186	4.4e-37	PFAM
low complexity region	416	429	N/A	INTRINSIC
low complexity region	448	459	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148720

SMART Domains

Protein: ENSMUSP00000116180
Gene: ENSMUSG00000036923

Domain	Start	End	E-Value	Type
Pfam:Stork_head	19	98	9e-40	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may function as a DNA binding protein. Mutations in this gene are associated with pre-eclampsia/eclampsia 4 (PEE4). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
4933412E24Rik	T	A	15: 60,016,423	E56V	possibly damaging	Het
Adam28	A	G	14: 68,622,082		probably null	Het
Bnc1	G	T	7: 81,968,960	H786N	probably benign	Het
Cav1	T	A	6: 17,339,249	M100K	probably benign	Het
Cdk9	A	G	2: 32,708,072	L273P	probably damaging	Het
Celsr1	A	G	15: 85,927,999	V2065A	probably damaging	Het
Cyp2c54	T	C	19: 40,038,259	Q484R	probably benign	Het
Elfn1	T	C	5: 139,972,194	S318P	possibly damaging	Het
Fam160b1	G	T	19: 57,385,397		probably null	Het
Fbxl6	T	C	15: 76,537,724	E205G	possibly damaging	Het
Frmd6	T	A	12: 70,877,249	Y94N	probably benign	Het
Gdpd1	A	T	11: 87,035,288	V277D	probably benign	Het
Gm1141	G	A	X: 71,939,619	C399Y	possibly damaging	Het
Grik1	C	A	16: 88,051,461	V140L	probably benign	Het
Grpel1	A	G	5: 36,471,272	H175R	probably damaging	Het
Gtdc1	G	T	2: 44,575,590		probably null	Het
Hivep2	A	T	10: 14,129,170	Q504L	probably benign	Het
Icos	A	T	1: 60,994,690	I160L	probably benign	Het
Igsf9b	G	T	9: 27,322,917	C442F	probably damaging	Het
Itga10	T	C	3: 96,658,246	V1062A	possibly damaging	Het
Lrp1b	C	T	2: 40,663,667	V386I	unknown	Het
Lrp2	G	T	2: 69,527,231	F409L	probably benign	Het
Nadk	T	G	4: 155,587,726	Y291*	probably null	Het
Nudt6	A	T	3: 37,405,229		probably null	Het
Oit3	T	C	10: 59,428,103	Y403C	probably damaging	Het
Olfr694	G	A	7: 106,689,011	T240I	probably benign	Het
Olfr814	T	C	10: 129,873,957	T267A	probably benign	Het
Olfr974	A	G	9: 39,942,428	H56R	probably damaging	Het
Pds5b	C	T	5: 150,736,396	P275S	probably damaging	Het
Pdzd7	T	A	19: 45,040,580	E117V	probably damaging	Het
Pik3ca	T	C	3: 32,461,530	V784A	probably damaging	Het
Polr3e	T	C	7: 120,939,057		probably null	Het
Rab3gap2	A	T	1: 185,282,347	D1231V	probably benign	Het
Rapgef2	C	A	3: 79,069,057	G1481*	probably null	Het
Rho	G	A	6: 115,935,230	V76I	probably benign	Het
Rrm1	A	G	7: 102,447,801	D96G	probably benign	Het
Slc35b2	G	A	17: 45,566,429	V161M	probably benign	Het
Srp9	A	T	1: 182,131,411	M50L	probably benign	Het
Sult1d1	A	G	5: 87,558,576	F169S	probably damaging	Het
Tmem63c	C	G	12: 87,081,902	T567R	probably benign	Het
Tmf1	G	T	6: 97,178,988	F12L	probably damaging	Het
Ush2a	T	C	1: 188,356,874	I342T	probably damaging	Het
Veph1	A	T	3: 66,061,185	N712K	probably damaging	Het
Vti1a	T	G	19: 55,380,948	S91A	probably benign	Het

Other mutations in Stox1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Stox1	APN	10	62667913	missense	probably damaging	1.00
IGL01462:Stox1	APN	10	62664682	missense	probably benign	0.14
IGL01558:Stox1	APN	10	62667872	missense	probably damaging	0.98
IGL02391:Stox1	APN	10	62659676	splice site	probably benign
IGL02454:Stox1	APN	10	62667826	missense	probably damaging	1.00
IGL02510:Stox1	APN	10	62664047	missense	probably benign	0.14
IGL02635:Stox1	APN	10	62664906	missense	probably benign	0.02
R1036:Stox1	UTSW	10	62667895	missense	probably damaging	1.00
R1486:Stox1	UTSW	10	62664636	missense	probably benign	0.06
R1751:Stox1	UTSW	10	62659666	missense	probably damaging	0.97
R1763:Stox1	UTSW	10	62667965	missense	probably damaging	1.00
R1892:Stox1	UTSW	10	62665399	missense	possibly damaging	0.56
R2128:Stox1	UTSW	10	62664535	missense	probably benign	0.42
R2406:Stox1	UTSW	10	62664166	missense	probably benign	0.01
R4078:Stox1	UTSW	10	62666031	missense	probably benign	0.00
R4414:Stox1	UTSW	10	62659569	missense	probably benign	0.00
R4415:Stox1	UTSW	10	62659569	missense	probably benign	0.00
R4417:Stox1	UTSW	10	62659569	missense	probably benign	0.00
R4799:Stox1	UTSW	10	62665737	missense	probably damaging	1.00
R5261:Stox1	UTSW	10	62667841	missense	probably damaging	0.98
R5323:Stox1	UTSW	10	62664033	missense	possibly damaging	0.71
R5885:Stox1	UTSW	10	62664848	missense	probably damaging	0.99
R6182:Stox1	UTSW	10	62664942	missense	probably damaging	0.99
R7548:Stox1	UTSW	10	62666167	missense	probably damaging	0.99
R7757:Stox1	UTSW	10	62663964	missense	probably damaging	1.00
R7765:Stox1	UTSW	10	62665999	missense	probably benign	0.26
R7846:Stox1	UTSW	10	62659526	missense	probably damaging	1.00
R7867:Stox1	UTSW	10	62664944	missense	probably benign	0.00
R8077:Stox1	UTSW	10	62665566	missense	probably damaging	1.00
R8409:Stox1	UTSW	10	62666016	missense	probably benign	0.00
R8413:Stox1	UTSW	10	62664975	missense	probably damaging	1.00
R8443:Stox1	UTSW	10	62665764	missense	probably damaging	1.00
R8822:Stox1	UTSW	10	62664121	missense	probably damaging	1.00
R8888:Stox1	UTSW	10	62659607	missense	probably benign	0.05
R8895:Stox1	UTSW	10	62659607	missense	probably benign	0.05
R8937:Stox1	UTSW	10	62664651	missense	probably damaging	0.96
R9012:Stox1	UTSW	10	62664832	missense	probably benign	0.00
R9201:Stox1	UTSW	10	62665573	missense	probably damaging	1.00
RF014:Stox1	UTSW	10	62664246	missense	probably benign	0.06
Z1176:Stox1	UTSW	10	62664018	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACAGCTTCCAAGGACTTTCAC -3'
(R):5'- TCCTAATGGTACTGGGAGGC -3'

Sequencing Primer
(F):5'- CCAGTTTCTACAAGAGTTCTCCAAAG -3'
(R):5'- ACATGAGAATGTGTTTCTGAAGG -3'

Posted On

2015-07-07