Incidental Mutation 'R4416:Gdpd1'
ID326849
Institutional Source Beutler Lab
Gene Symbol Gdpd1
Ensembl Gene ENSMUSG00000061666
Gene Nameglycerophosphodiester phosphodiesterase domain containing 1
Synonyms
MMRRC Submission 041137-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R4416 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location87033867-87074062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87035288 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 277 (V277D)
Ref Sequence ENSEMBL: ENSMUSP00000020804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020804]
Predicted Effect probably benign
Transcript: ENSMUST00000020804
AA Change: V277D

PolyPhen 2 Score 0.443 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020804
Gene: ENSMUSG00000061666
AA Change: V277D

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:GDPD 45 204 1.2e-26 PFAM
low complexity region 206 217 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycerophosphodiester phosphodiesterase family of enzymes that catalyze the hydrolysis of deacylated glycerophospholipids to glycerol phosphate and alcohol. The encoded protein is localized to the cytoplasm and concentrates near the perinuclear region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4933412E24Rik T A 15: 60,016,423 E56V possibly damaging Het
Adam28 A G 14: 68,622,082 probably null Het
Bnc1 G T 7: 81,968,960 H786N probably benign Het
Cav1 T A 6: 17,339,249 M100K probably benign Het
Cdk9 A G 2: 32,708,072 L273P probably damaging Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cyp2c54 T C 19: 40,038,259 Q484R probably benign Het
Elfn1 T C 5: 139,972,194 S318P possibly damaging Het
Fam160b1 G T 19: 57,385,397 probably null Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Frmd6 T A 12: 70,877,249 Y94N probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Grik1 C A 16: 88,051,461 V140L probably benign Het
Grpel1 A G 5: 36,471,272 H175R probably damaging Het
Gtdc1 G T 2: 44,575,590 probably null Het
Hivep2 A T 10: 14,129,170 Q504L probably benign Het
Icos A T 1: 60,994,690 I160L probably benign Het
Igsf9b G T 9: 27,322,917 C442F probably damaging Het
Itga10 T C 3: 96,658,246 V1062A possibly damaging Het
Lrp1b C T 2: 40,663,667 V386I unknown Het
Lrp2 G T 2: 69,527,231 F409L probably benign Het
Nadk T G 4: 155,587,726 Y291* probably null Het
Nudt6 A T 3: 37,405,229 probably null Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr694 G A 7: 106,689,011 T240I probably benign Het
Olfr814 T C 10: 129,873,957 T267A probably benign Het
Olfr974 A G 9: 39,942,428 H56R probably damaging Het
Pds5b C T 5: 150,736,396 P275S probably damaging Het
Pdzd7 T A 19: 45,040,580 E117V probably damaging Het
Pik3ca T C 3: 32,461,530 V784A probably damaging Het
Polr3e T C 7: 120,939,057 probably null Het
Rab3gap2 A T 1: 185,282,347 D1231V probably benign Het
Rapgef2 C A 3: 79,069,057 G1481* probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rrm1 A G 7: 102,447,801 D96G probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Srp9 A T 1: 182,131,411 M50L probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Sult1d1 A G 5: 87,558,576 F169S probably damaging Het
Tmem63c C G 12: 87,081,902 T567R probably benign Het
Tmf1 G T 6: 97,178,988 F12L probably damaging Het
Ush2a T C 1: 188,356,874 I342T probably damaging Het
Veph1 A T 3: 66,061,185 N712K probably damaging Het
Vti1a T G 19: 55,380,948 S91A probably benign Het
Other mutations in Gdpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02279:Gdpd1 APN 11 87073901 missense probably benign 0.00
IGL02585:Gdpd1 APN 11 87073976 start codon destroyed probably null 0.98
PIT4687001:Gdpd1 UTSW 11 87059540 missense probably damaging 1.00
R0947:Gdpd1 UTSW 11 87037881 missense probably benign
R1454:Gdpd1 UTSW 11 87059509 missense possibly damaging 0.95
R2086:Gdpd1 UTSW 11 87035268 missense probably benign
R2183:Gdpd1 UTSW 11 87035276 missense probably damaging 1.00
R5517:Gdpd1 UTSW 11 87059506 missense probably damaging 1.00
R7038:Gdpd1 UTSW 11 87035292 missense probably damaging 1.00
R7898:Gdpd1 UTSW 11 87041813 missense probably damaging 0.98
R7981:Gdpd1 UTSW 11 87041813 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGTTAACACACCTTCCCTCAG -3'
(R):5'- CCGATGTAATGGGGACTGTATG -3'

Sequencing Primer
(F):5'- CAGATCTATTCTGGTCATGACTCC -3'
(R):5'- GTATGCGCTTCCTCACAGTTAG -3'
Posted On2015-07-07