Mutagenetix > Incidental Mutation

Incidental Mutation 'R4416:Grik1'

326855

Institutional Source

Beutler Lab

Gene Symbol

Grik1

Ensembl Gene

ENSMUSG00000022935

Gene Name

glutamate receptor, ionotropic, kainate 1

Synonyms

Glurbeta1, Glur5, D16Ium24e, Glur-5, D16Ium24, GluK5, A830007B11Rik

MMRRC Submission

041137-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4416 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87895900-88290265 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 88051461 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 140 (V140L)

Ref Sequence

ENSEMBL: ENSMUSP00000153786 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023652] [ENSMUST00000072256] [ENSMUST00000114137] [ENSMUST00000211444] [ENSMUST00000227986] [ENSMUST00000228034] [ENSMUST00000228188]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000023652
AA Change: V140L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000023652
Gene: ENSMUSG00000022935
AA Change: V140L

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	14	357	4.7e-69	PFAM
Pfam:Peripla_BP_6	48	347	5.1e-11	PFAM
PBPe	394	762	2.4e-130	SMART
Lig_chan-Glu_bd	404	468	6.34e-31	SMART
Blast:PBPe	770	815	2e-16	BLAST
low complexity region	829	850	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000072256
AA Change: V140L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000072107
Gene: ENSMUSG00000022935
AA Change: V140L

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	14	357	2.6e-72	PFAM
Pfam:Peripla_BP_6	49	347	3.4e-10	PFAM
PBPe	394	762	2.4e-130	SMART
Lig_chan-Glu_bd	404	468	6.34e-31	SMART
Blast:PBPe	770	817	1e-17	BLAST
low complexity region	858	879	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114137
AA Change: V69L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000109773
Gene: ENSMUSG00000022935
AA Change: V69L

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	1	325	5.4e-63	PFAM
Pfam:Peripla_BP_6	18	315	5.1e-11	PFAM
PBPe	362	730	2.4e-130	SMART
Lig_chan-Glu_bd	372	436	6.34e-31	SMART
Blast:PBPe	738	783	2e-16	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210910

Predicted Effect

probably benign
Transcript: ENSMUST00000211444
AA Change: V140L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211635

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226447

Predicted Effect

probably benign
Transcript: ENSMUST00000227986
AA Change: V140L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000228034
AA Change: V140L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000228188
AA Change: V140L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to alter the properties of ion flow. Alternative splicing, resulting in transcript variants encoding different isoforms, has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display subtile abnormalities in the electrophysiology of neurons in the brain. Response to chemical pain stimuli is also reduced. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
4933412E24Rik	T	A	15: 60,016,423	E56V	possibly damaging	Het
Adam28	A	G	14: 68,622,082		probably null	Het
Bnc1	G	T	7: 81,968,960	H786N	probably benign	Het
Cav1	T	A	6: 17,339,249	M100K	probably benign	Het
Cdk9	A	G	2: 32,708,072	L273P	probably damaging	Het
Celsr1	A	G	15: 85,927,999	V2065A	probably damaging	Het
Cyp2c54	T	C	19: 40,038,259	Q484R	probably benign	Het
Elfn1	T	C	5: 139,972,194	S318P	possibly damaging	Het
Fam160b1	G	T	19: 57,385,397		probably null	Het
Fbxl6	T	C	15: 76,537,724	E205G	possibly damaging	Het
Frmd6	T	A	12: 70,877,249	Y94N	probably benign	Het
Gdpd1	A	T	11: 87,035,288	V277D	probably benign	Het
Gm1141	G	A	X: 71,939,619	C399Y	possibly damaging	Het
Grpel1	A	G	5: 36,471,272	H175R	probably damaging	Het
Gtdc1	G	T	2: 44,575,590		probably null	Het
Hivep2	A	T	10: 14,129,170	Q504L	probably benign	Het
Icos	A	T	1: 60,994,690	I160L	probably benign	Het
Igsf9b	G	T	9: 27,322,917	C442F	probably damaging	Het
Itga10	T	C	3: 96,658,246	V1062A	possibly damaging	Het
Lrp1b	C	T	2: 40,663,667	V386I	unknown	Het
Lrp2	G	T	2: 69,527,231	F409L	probably benign	Het
Nadk	T	G	4: 155,587,726	Y291*	probably null	Het
Nudt6	A	T	3: 37,405,229		probably null	Het
Oit3	T	C	10: 59,428,103	Y403C	probably damaging	Het
Olfr694	G	A	7: 106,689,011	T240I	probably benign	Het
Olfr814	T	C	10: 129,873,957	T267A	probably benign	Het
Olfr974	A	G	9: 39,942,428	H56R	probably damaging	Het
Pds5b	C	T	5: 150,736,396	P275S	probably damaging	Het
Pdzd7	T	A	19: 45,040,580	E117V	probably damaging	Het
Pik3ca	T	C	3: 32,461,530	V784A	probably damaging	Het
Polr3e	T	C	7: 120,939,057		probably null	Het
Rab3gap2	A	T	1: 185,282,347	D1231V	probably benign	Het
Rapgef2	C	A	3: 79,069,057	G1481*	probably null	Het
Rho	G	A	6: 115,935,230	V76I	probably benign	Het
Rrm1	A	G	7: 102,447,801	D96G	probably benign	Het
Slc35b2	G	A	17: 45,566,429	V161M	probably benign	Het
Srp9	A	T	1: 182,131,411	M50L	probably benign	Het
Stox1	T	C	10: 62,659,569	N975S	probably benign	Het
Sult1d1	A	G	5: 87,558,576	F169S	probably damaging	Het
Tmem63c	C	G	12: 87,081,902	T567R	probably benign	Het
Tmf1	G	T	6: 97,178,988	F12L	probably damaging	Het
Ush2a	T	C	1: 188,356,874	I342T	probably damaging	Het
Veph1	A	T	3: 66,061,185	N712K	probably damaging	Het
Vti1a	T	G	19: 55,380,948	S91A	probably benign	Het

Other mutations in Grik1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01143:Grik1	APN	16	87957600	splice site	probably null
IGL01347:Grik1	APN	16	87957593	missense	probably benign	0.00
IGL01612:Grik1	APN	16	87946735	missense	probably damaging	1.00
IGL02010:Grik1	APN	16	88051508	missense	possibly damaging	0.96
IGL02059:Grik1	APN	16	88056049	missense	possibly damaging	0.95
IGL02068:Grik1	APN	16	87940651	missense	possibly damaging	0.80
IGL02200:Grik1	APN	16	87940565	missense	probably damaging	1.00
IGL02206:Grik1	APN	16	87935920	missense	probably damaging	1.00
IGL02375:Grik1	APN	16	87946556	missense	probably damaging	1.00
IGL02598:Grik1	APN	16	87947984	missense	probably damaging	1.00
IGL02686:Grik1	APN	16	88009761	splice site	probably null
IGL02890:Grik1	APN	16	87896802	intron	probably benign
R0096:Grik1	UTSW	16	88034226	missense	possibly damaging	0.55
R0096:Grik1	UTSW	16	88034226	missense	possibly damaging	0.55
R0387:Grik1	UTSW	16	88034350	splice site	probably benign
R0613:Grik1	UTSW	16	88051333	critical splice donor site	probably null
R1087:Grik1	UTSW	16	88006377	missense	probably benign	0.00
R1694:Grik1	UTSW	16	87950068	missense	probably damaging	0.96
R1905:Grik1	UTSW	16	87896866	nonsense	probably null
R1928:Grik1	UTSW	16	88051353	missense	probably damaging	0.99
R2157:Grik1	UTSW	16	88056124	missense	probably damaging	1.00
R3122:Grik1	UTSW	16	88006473	missense	probably damaging	1.00
R3906:Grik1	UTSW	16	88006449	missense	probably benign	0.00
R4194:Grik1	UTSW	16	87946728	missense	probably benign	0.45
R4343:Grik1	UTSW	16	87896252	missense	probably benign	0.00
R4349:Grik1	UTSW	16	87957543	missense	probably damaging	1.00
R4423:Grik1	UTSW	16	87923200	missense	probably benign	0.10
R4660:Grik1	UTSW	16	87923131	missense	probably damaging	1.00
R4804:Grik1	UTSW	16	87957569	missense	probably damaging	0.99
R5052:Grik1	UTSW	16	87950098	missense	probably benign	0.01
R5126:Grik1	UTSW	16	87947859	missense	probably damaging	1.00
R5334:Grik1	UTSW	16	87923194	frame shift	probably null
R5335:Grik1	UTSW	16	87923194	frame shift	probably null
R5337:Grik1	UTSW	16	87923194	frame shift	probably null
R5479:Grik1	UTSW	16	87936026	missense	probably damaging	1.00
R6141:Grik1	UTSW	16	87896872	missense	probably benign	0.00
R6188:Grik1	UTSW	16	88056071	missense	probably benign	0.06
R6335:Grik1	UTSW	16	87947906	missense	probably damaging	1.00
R6610:Grik1	UTSW	16	88034312	missense	probably damaging	1.00
R6737:Grik1	UTSW	16	88051391	missense	probably damaging	1.00
R7275:Grik1	UTSW	16	87912820	missense	probably benign	0.06
R7876:Grik1	UTSW	16	87923233	missense
R8021:Grik1	UTSW	16	87914222	missense
R8027:Grik1	UTSW	16	87936005	missense
R8096:Grik1	UTSW	16	88006467	missense
R8266:Grik1	UTSW	16	87947979	missense	probably benign
R8515:Grik1	UTSW	16	87923282	nonsense	probably null
R8922:Grik1	UTSW	16	87896279	missense	unknown
R9097:Grik1	UTSW	16	87935908	missense
R9125:Grik1	UTSW	16	88056068	missense
R9273:Grik1	UTSW	16	88051491	missense
R9286:Grik1	UTSW	16	88051427	missense
R9491:Grik1	UTSW	16	87950107	missense
RF016:Grik1	UTSW	16	88034186	missense
RF022:Grik1	UTSW	16	87896337	missense
X0018:Grik1	UTSW	16	87946596	missense	probably damaging	1.00
Z1177:Grik1	UTSW	16	87946684	missense

Predicted Primers

PCR Primer
(F):5'- TAGGGCTGGCAAATGGAGAAATT -3'
(R):5'- CGAATTCATAGAACTCTCTCATTCTCA -3'

Sequencing Primer
(F):5'- GATGAGGGTCTTAAAGTCCATACCC -3'
(R):5'- AGAACTCTCTCATTCTCACCCTTTC -3'

Posted On

2015-07-07