Incidental Mutation 'R0016:Cyp4a10'
ID32686
Institutional Source Beutler Lab
Gene Symbol Cyp4a10
Ensembl Gene ENSMUSG00000066072
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 10
SynonymsRP1, D4Rp1, Cyp4a
MMRRC Submission 038311-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0016 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location115518264-115533649 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115521107 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 130 (Q130L)
Ref Sequence ENSEMBL: ENSMUSP00000092486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058785] [ENSMUST00000094886]
Predicted Effect probably damaging
Transcript: ENSMUST00000058785
AA Change: Q140L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000061126
Gene: ENSMUSG00000066072
AA Change: Q140L

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 504 2.3e-133 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094886
AA Change: Q130L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092486
Gene: ENSMUSG00000066072
AA Change: Q130L

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Pfam:p450 51 494 4.5e-129 PFAM
Meta Mutation Damage Score 0.5602 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display salt-sensitive hypertension, decrease sodium excretion, and decreased urine output. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,294,800 V1181G probably benign Het
Adamts12 A T 15: 11,217,829 I291F probably damaging Het
Aspm G C 1: 139,479,544 Q2056H probably benign Het
BC067074 T C 13: 113,366,105 Y115H probably damaging Het
C7 A T 15: 5,046,924 V122E probably benign Het
Casp12 A T 9: 5,352,844 Q152L probably null Het
Cdh16 T A 8: 104,617,632 T92S probably benign Het
Chrd G C 16: 20,734,308 V162L possibly damaging Het
Cpne8 A G 15: 90,501,405 probably benign Het
Cyp2j7 T A 4: 96,202,147 I347F probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Dgkd T C 1: 87,917,952 S294P probably benign Het
Dnah8 A G 17: 30,663,316 I621V probably benign Het
Dync2h1 A G 9: 7,144,346 probably benign Het
Echdc1 A T 10: 29,322,421 probably benign Het
Elovl3 T A 19: 46,132,158 F30Y probably damaging Het
Fa2h T C 8: 111,393,514 Y80C probably damaging Het
Fam208b A C 13: 3,585,170 probably null Het
Fgd3 C T 13: 49,296,609 D55N probably benign Het
Fhod1 T C 8: 105,331,655 E823G possibly damaging Het
Gapvd1 A G 2: 34,699,913 probably benign Het
Gm17067 A T 7: 42,708,622 I152K probably benign Het
Gm1966 G A 7: 106,603,246 L264F probably benign Het
Gm9833 A T 3: 10,089,319 M383L possibly damaging Het
Kif27 A G 13: 58,354,714 V50A probably damaging Het
Kpna2 T C 11: 106,991,086 T305A probably benign Het
Krtap22-2 A G 16: 89,010,519 probably benign Het
Lrp2bp T A 8: 46,012,031 F62L probably damaging Het
Marf1 G A 16: 14,152,265 H197Y probably damaging Het
Mob3b A G 4: 35,083,947 F81L probably benign Het
Mon2 C T 10: 123,035,546 V389M probably damaging Het
Myh8 A G 11: 67,298,525 K1176E probably damaging Het
Naf1 T C 8: 66,889,055 probably benign Het
Nckap1l A G 15: 103,475,636 T554A probably benign Het
Oog3 A G 4: 144,158,071 Y432H probably damaging Het
Paxbp1 A T 16: 91,036,036 probably benign Het
Phf20 A T 2: 156,267,194 K154* probably null Het
Plekhj1 T C 10: 80,796,416 D74G possibly damaging Het
Plpp4 T C 7: 129,323,424 C128R probably damaging Het
Rcan3 A T 4: 135,418,378 probably null Het
Sh3rf1 T A 8: 61,374,138 M642K probably benign Het
Slc7a1 A G 5: 148,334,583 V522A probably benign Het
Sorbs1 A G 19: 40,314,738 probably benign Het
Spry2 C T 14: 105,893,297 V152M probably benign Het
Srgap2 A G 1: 131,349,462 M349T possibly damaging Het
Stag3 A G 5: 138,291,381 H271R possibly damaging Het
Stat4 T C 1: 52,068,780 V136A probably benign Het
Stc2 A T 11: 31,360,177 D286E probably benign Het
Stk31 T C 6: 49,437,377 Y482H probably damaging Het
Ticrr C T 7: 79,693,792 P1135L probably benign Het
Tmem55b C T 14: 50,928,894 R213Q probably damaging Het
Trim27 A T 13: 21,191,229 E310V probably benign Het
Uvrag T C 7: 98,991,981 K284R probably benign Het
Vmn1r78 A C 7: 12,153,352 S297R probably benign Het
Xylt2 A G 11: 94,669,640 S270P probably damaging Het
Zfhx3 T C 8: 108,950,178 M2620T probably benign Het
Zkscan2 C A 7: 123,499,996 probably benign Het
Zwint T C 10: 72,657,198 probably benign Het
Other mutations in Cyp4a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00774:Cyp4a10 APN 4 115532538 missense probably damaging 1.00
IGL01301:Cyp4a10 APN 4 115518455 missense probably damaging 1.00
IGL02081:Cyp4a10 APN 4 115521172 missense possibly damaging 0.87
IGL02373:Cyp4a10 APN 4 115521077 nonsense probably null
IGL03411:Cyp4a10 APN 4 115525693 splice site probably null
ANU18:Cyp4a10 UTSW 4 115518455 missense probably damaging 1.00
PIT4142001:Cyp4a10 UTSW 4 115524875 missense probably damaging 0.99
PIT4151001:Cyp4a10 UTSW 4 115524875 missense probably damaging 0.99
R0368:Cyp4a10 UTSW 4 115525377 nonsense probably null
R1319:Cyp4a10 UTSW 4 115521145 missense probably damaging 0.98
R1440:Cyp4a10 UTSW 4 115529449 missense probably damaging 1.00
R1531:Cyp4a10 UTSW 4 115518435 nonsense probably null
R2008:Cyp4a10 UTSW 4 115525392 missense probably damaging 0.98
R2064:Cyp4a10 UTSW 4 115524720 splice site probably benign
R2083:Cyp4a10 UTSW 4 115525308 missense possibly damaging 0.86
R2961:Cyp4a10 UTSW 4 115520270 missense probably benign 0.02
R3028:Cyp4a10 UTSW 4 115518431 missense possibly damaging 0.64
R3839:Cyp4a10 UTSW 4 115525347 missense possibly damaging 0.85
R3930:Cyp4a10 UTSW 4 115524783 missense probably benign 0.00
R4062:Cyp4a10 UTSW 4 115519701 missense probably benign 0.06
R4097:Cyp4a10 UTSW 4 115529283 missense probably damaging 0.99
R4298:Cyp4a10 UTSW 4 115532692 missense probably damaging 1.00
R4482:Cyp4a10 UTSW 4 115532598 missense probably damaging 1.00
R4592:Cyp4a10 UTSW 4 115529493 missense probably damaging 0.99
R4715:Cyp4a10 UTSW 4 115525338 missense probably benign 0.44
R4826:Cyp4a10 UTSW 4 115518344 missense probably benign 0.00
R4834:Cyp4a10 UTSW 4 115525808 missense probably damaging 1.00
R4922:Cyp4a10 UTSW 4 115521094 missense probably benign 0.01
R5202:Cyp4a10 UTSW 4 115532615 missense probably damaging 1.00
R5502:Cyp4a10 UTSW 4 115525505 missense probably benign 0.21
R6269:Cyp4a10 UTSW 4 115524312 missense probably damaging 1.00
R6349:Cyp4a10 UTSW 4 115525358 missense probably benign 0.00
R7684:Cyp4a10 UTSW 4 115518352 missense probably benign 0.18
R7863:Cyp4a10 UTSW 4 115518425 missense probably benign 0.00
R7946:Cyp4a10 UTSW 4 115518425 missense probably benign 0.00
Z1176:Cyp4a10 UTSW 4 115518326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCCTTGCCCCAATTTATCTAATGG -3'
(R):5'- TGGCACCTGTGGCAGTAGTAGTAG -3'

Sequencing Primer
(F):5'- tgtttgtttgtttgtttgtttgtttg -3'
(R):5'- gtggcagtagtagtagcagaag -3'
Posted On2013-05-09