Incidental Mutation 'R4417:Stradb'
ID326862
Institutional Source Beutler Lab
Gene Symbol Stradb
Ensembl Gene ENSMUSG00000026027
Gene NameSTE20-related kinase adaptor beta
SynonymsAls2cr2, D1Ucla2, PRO1038
MMRRC Submission 041138-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4417 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58973522-58995715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58994372 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 398 (V398A)
Ref Sequence ENSEMBL: ENSMUSP00000027185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027185] [ENSMUST00000114296] [ENSMUST00000123301] [ENSMUST00000153990]
Predicted Effect probably benign
Transcript: ENSMUST00000027185
AA Change: V398A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027185
Gene: ENSMUSG00000026027
AA Change: V398A

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 58 290 3.2e-26 PFAM
Pfam:Pkinase 58 369 7.9e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000054653
Predicted Effect probably benign
Transcript: ENSMUST00000114296
SMART Domains Protein: ENSMUSP00000109935
Gene: ENSMUSG00000026027

DomainStartEndE-ValueType
Pfam:Pkinase 58 185 1.1e-16 PFAM
Pfam:Pkinase_Tyr 58 188 1.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123301
SMART Domains Protein: ENSMUSP00000138036
Gene: ENSMUSG00000026027

DomainStartEndE-ValueType
Pfam:Pkinase 58 184 2.7e-17 PFAM
Pfam:Pkinase_Tyr 58 185 1.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152318
Predicted Effect probably benign
Transcript: ENSMUST00000153990
Meta Mutation Damage Score 0.0866 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase STE20 subfamily. One of the active site residues in the protein kinase domain of this protein is altered, and it is thus a pseudokinase. This protein is a component of a complex involved in the activation of serine/threonine kinase 11, a master kinase that regulates cell polarity and energy-generating metabolism. This complex regulates the relocation of this kinase from the nucleus to the cytoplasm, and it is essential for G1 cell cycle arrest mediated by this kinase. The protein encoded by this gene can also interact with the X chromosome-linked inhibitor of apoptosis protein, and this interaction enhances the anti-apoptotic activity of this protein via the JNK1 signal transduction pathway. Two pseudogenes, located on chromosomes 1 and 7, have been found for this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
BC004004 G A 17: 29,282,275 probably benign Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E61G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Crhbp T C 13: 95,443,877 S65G probably benign Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glp2r T C 11: 67,664,516 probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Kcnj2 T C 11: 111,072,189 S136P probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lcp2 G T 11: 34,050,917 E33D probably benign Het
Lrrc32 G T 7: 98,498,937 R308L probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mfsd12 A G 10: 81,364,703 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Odf2 T A 2: 29,915,321 probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Prdm13 T C 4: 21,678,756 E578G probably benign Het
Pum3 A G 19: 27,422,716 I183T probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tlr4 A T 4: 66,839,303 N111I probably damaging Het
Tnip2 G A 5: 34,503,581 R176* probably null Het
Tomm7 A G 5: 23,843,979 I32T probably benign Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zfp341 T C 2: 154,628,987 L308P possibly damaging Het
Zmym6 T C 4: 127,092,988 S154P probably damaging Het
Other mutations in Stradb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00784:Stradb APN 1 58988529 missense probably damaging 0.98
IGL00843:Stradb APN 1 58994409 missense probably benign
IGL01288:Stradb APN 1 58992301 missense possibly damaging 0.61
IGL02045:Stradb APN 1 58989778 missense probably damaging 1.00
IGL02818:Stradb APN 1 58979962 missense probably damaging 0.99
P0047:Stradb UTSW 1 58989798 missense probably null 0.86
R0739:Stradb UTSW 1 58977015 unclassified probably benign
R0970:Stradb UTSW 1 58977060 missense possibly damaging 0.92
R1809:Stradb UTSW 1 58994390 missense possibly damaging 0.54
R1930:Stradb UTSW 1 58991105 missense probably benign 0.07
R1931:Stradb UTSW 1 58991105 missense probably benign 0.07
R1932:Stradb UTSW 1 58991105 missense probably benign 0.07
R2570:Stradb UTSW 1 58988584 missense probably damaging 1.00
R2919:Stradb UTSW 1 58992669 missense probably benign 0.44
R3104:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3105:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3106:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3772:Stradb UTSW 1 58985385 missense probably benign 0.04
R4120:Stradb UTSW 1 58980009 missense possibly damaging 0.92
R4569:Stradb UTSW 1 58979958 nonsense probably null
R4601:Stradb UTSW 1 58993572 missense probably damaging 0.98
R4758:Stradb UTSW 1 58988571 missense probably benign 0.02
R4786:Stradb UTSW 1 58991208 intron probably benign
R4944:Stradb UTSW 1 58980440 missense probably benign 0.27
R5113:Stradb UTSW 1 58991174 intron probably benign
R5568:Stradb UTSW 1 58992742 missense possibly damaging 0.72
R5765:Stradb UTSW 1 58992744 missense probably benign 0.31
R5970:Stradb UTSW 1 58980016 critical splice donor site probably null
R6234:Stradb UTSW 1 58988548 missense probably damaging 1.00
R7411:Stradb UTSW 1 58988518 missense possibly damaging 0.95
R7511:Stradb UTSW 1 58992949 missense probably damaging 0.97
R7569:Stradb UTSW 1 58991151 missense unknown
R7575:Stradb UTSW 1 58988580 missense probably benign 0.00
R7646:Stradb UTSW 1 58994408 missense probably benign 0.14
R7658:Stradb UTSW 1 58992726 missense probably damaging 0.96
R8306:Stradb UTSW 1 58991197 missense unknown
R8812:Stradb UTSW 1 58994319 missense probably benign 0.16
Z1176:Stradb UTSW 1 58992999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTTTCTCGATTGTCAGAACTAG -3'
(R):5'- CCAGTGCACCAACTGTATTTTC -3'

Sequencing Primer
(F):5'- TGTCAGAACTAGAAGCATTTAAAAGG -3'
(R):5'- TGCACCAACTGTATTTTCAAGTATAG -3'
Posted On2015-07-07