Incidental Mutation 'R4417:Odf2'
ID326867
Institutional Source Beutler Lab
Gene Symbol Odf2
Ensembl Gene ENSMUSG00000026790
Gene Nameouter dense fiber of sperm tails 2
SynonymsMMTEST29, cenexin
MMRRC Submission 041138-MU
Accession Numbers

Genbank: NM_001113213; MGI: 1098824 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4417 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location29889221-29931746 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 29915321 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028128] [ENSMUST00000046571] [ENSMUST00000113755] [ENSMUST00000113756] [ENSMUST00000113757] [ENSMUST00000113759] [ENSMUST00000113762] [ENSMUST00000113763] [ENSMUST00000113764] [ENSMUST00000113765] [ENSMUST00000113767] [ENSMUST00000184845]
Predicted Effect probably benign
Transcript: ENSMUST00000028128
SMART Domains Protein: ENSMUSP00000028128
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
coiled coil region 125 197 N/A INTRINSIC
internal_repeat_1 248 284 1.04e-5 PROSPERO
internal_repeat_1 447 481 1.04e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000046571
SMART Domains Protein: ENSMUSP00000049272
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.77e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.77e-5 PROSPERO
internal_repeat_1 262 298 8.12e-7 PROSPERO
internal_repeat_1 461 495 8.12e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113755
SMART Domains Protein: ENSMUSP00000109384
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_1 262 298 2.12e-5 PROSPERO
internal_repeat_1 461 495 2.12e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113756
SMART Domains Protein: ENSMUSP00000109385
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.77e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.77e-5 PROSPERO
internal_repeat_1 262 298 8.12e-7 PROSPERO
internal_repeat_1 461 495 8.12e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113757
SMART Domains Protein: ENSMUSP00000109386
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
internal_repeat_2 101 119 9.13e-6 PROSPERO
coiled coil region 120 192 N/A INTRINSIC
internal_repeat_2 199 217 9.13e-6 PROSPERO
internal_repeat_1 243 279 3.83e-7 PROSPERO
internal_repeat_1 442 476 3.83e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113759
SMART Domains Protein: ENSMUSP00000109388
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.82e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.82e-5 PROSPERO
internal_repeat_1 262 299 1.55e-6 PROSPERO
internal_repeat_1 462 496 1.55e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113762
SMART Domains Protein: ENSMUSP00000109391
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
coiled coil region 144 216 N/A INTRINSIC
internal_repeat_1 267 303 1.9e-5 PROSPERO
internal_repeat_1 466 500 1.9e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113763
SMART Domains Protein: ENSMUSP00000109392
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
coiled coil region 125 197 N/A INTRINSIC
internal_repeat_1 248 284 1.04e-5 PROSPERO
internal_repeat_1 447 481 1.04e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113764
SMART Domains Protein: ENSMUSP00000109393
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
coiled coil region 125 197 N/A INTRINSIC
internal_repeat_1 248 284 1.04e-5 PROSPERO
internal_repeat_1 447 481 1.04e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113765
SMART Domains Protein: ENSMUSP00000109394
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
internal_repeat_2 125 143 1.66e-5 PROSPERO
coiled coil region 144 216 N/A INTRINSIC
internal_repeat_2 223 241 1.66e-5 PROSPERO
internal_repeat_1 267 303 7.56e-7 PROSPERO
internal_repeat_1 466 500 7.56e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113767
SMART Domains Protein: ENSMUSP00000109396
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
coiled coil region 188 260 N/A INTRINSIC
internal_repeat_1 311 347 3e-5 PROSPERO
internal_repeat_1 510 544 3e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152503
Predicted Effect probably benign
Transcript: ENSMUST00000184845
SMART Domains Protein: ENSMUSP00000139390
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_1 262 298 3.95e-5 PROSPERO
internal_repeat_1 461 495 3.95e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152932
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The outer dense fibers are cytoskeletal structures that surround the axoneme in the middle piece and principal piece of the sperm tail. The fibers function in maintaining the elastic structure and recoil of the sperm tail as well as in protecting the tail from shear forces during epididymal transport and ejaculation. Defects in the outer dense fibers lead to abnormal sperm morphology and infertility. This gene encodes one of the major outer dense fiber proteins. Alternative splicing results in multiple transcript variants. The longer transcripts, also known as 'Cenexins', encode proteins with a C-terminal extension that are differentially targeted to somatic centrioles and thought to be crucial for the formation of microtubule organizing centers. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality before implantation and transmission ratio distortion while all heterozygous males display normal development and fertility. Males heterozygous for other alleles are either infertile orshow reduced fertility. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
BC004004 G A 17: 29,282,275 probably benign Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E61G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Crhbp T C 13: 95,443,877 S65G probably benign Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glp2r T C 11: 67,664,516 probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Kcnj2 T C 11: 111,072,189 S136P probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lcp2 G T 11: 34,050,917 E33D probably benign Het
Lrrc32 G T 7: 98,498,937 R308L probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mfsd12 A G 10: 81,364,703 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Prdm13 T C 4: 21,678,756 E578G probably benign Het
Pum3 A G 19: 27,422,716 I183T probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Stradb T C 1: 58,994,372 V398A probably benign Het
Tlr4 A T 4: 66,839,303 N111I probably damaging Het
Tnip2 G A 5: 34,503,581 R176* probably null Het
Tomm7 A G 5: 23,843,979 I32T probably benign Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zfp341 T C 2: 154,628,987 L308P possibly damaging Het
Zmym6 T C 4: 127,092,988 S154P probably damaging Het
Other mutations in Odf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Odf2 APN 2 29893059 missense probably damaging 1.00
IGL01511:Odf2 APN 2 29914309 splice site probably benign
IGL01760:Odf2 APN 2 29914460 missense probably damaging 1.00
IGL02487:Odf2 APN 2 29920839 missense possibly damaging 0.80
IGL03047:Odf2 APN 2 29920895 splice site probably benign
IGL03057:Odf2 APN 2 29923645 intron probably benign
IGL03064:Odf2 APN 2 29901079 missense probably benign 0.28
3-1:Odf2 UTSW 2 29904075 nonsense probably null
IGL02837:Odf2 UTSW 2 29926713 missense probably damaging 0.99
R4025:Odf2 UTSW 2 29926815 missense probably damaging 1.00
R4227:Odf2 UTSW 2 29901284 intron probably benign
R4357:Odf2 UTSW 2 29892244 missense probably benign 0.00
R4512:Odf2 UTSW 2 29926097 splice site probably null
R4705:Odf2 UTSW 2 29904034 missense probably damaging 1.00
R4815:Odf2 UTSW 2 29902240 missense possibly damaging 0.87
R5325:Odf2 UTSW 2 29912571 missense probably benign 0.19
R5614:Odf2 UTSW 2 29920867 missense probably damaging 0.99
R6998:Odf2 UTSW 2 29912617 missense probably benign 0.43
R7740:Odf2 UTSW 2 29930624 missense probably damaging 1.00
R7963:Odf2 UTSW 2 29926100 missense probably benign 0.44
R8548:Odf2 UTSW 2 29893514 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GATGTGATATCGCATGCCTGG -3'
(R):5'- AGAAGCTTCTCCCCTTGAGC -3'

Sequencing Primer
(F):5'- AGTATCTATCCTCTCACCTGGAG -3'
(R):5'- TCTCACATGCTAGGCAAATGAAG -3'
Posted On2015-07-07