Incidental Mutation 'R4417:Zfp341'
ID326869
Institutional Source Beutler Lab
Gene Symbol Zfp341
Ensembl Gene ENSMUSG00000059842
Gene Namezinc finger protein 341
Synonyms
MMRRC Submission 041138-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4417 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location154613297-154646821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154628987 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 308 (L308P)
Ref Sequence ENSEMBL: ENSMUSP00000080596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081926] [ENSMUST00000109702] [ENSMUST00000126421]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081926
AA Change: L308P

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080596
Gene: ENSMUSG00000059842
AA Change: L308P

DomainStartEndE-ValueType
ZnF_C2H2 53 73 4.16e1 SMART
low complexity region 96 110 N/A INTRINSIC
low complexity region 154 161 N/A INTRINSIC
low complexity region 177 200 N/A INTRINSIC
ZnF_C2H2 320 342 3.69e-4 SMART
ZnF_C2H2 348 370 1.04e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 470 494 2.17e-1 SMART
ZnF_C2H2 500 522 2.91e-2 SMART
ZnF_C2H2 537 561 1.23e0 SMART
ZnF_C2H2 563 585 3.58e-2 SMART
ZnF_C2H2 591 613 1.62e0 SMART
ZnF_C2H2 619 641 2.27e-4 SMART
ZnF_C2H2 647 674 7.29e0 SMART
ZnF_C2H2 680 702 5.14e-3 SMART
low complexity region 740 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109702
SMART Domains Protein: ENSMUSP00000105324
Gene: ENSMUSG00000059842

DomainStartEndE-ValueType
ZnF_C2H2 53 73 4.16e1 SMART
low complexity region 96 110 N/A INTRINSIC
low complexity region 154 161 N/A INTRINSIC
low complexity region 177 200 N/A INTRINSIC
ZnF_C2H2 313 335 3.69e-4 SMART
ZnF_C2H2 341 363 1.04e-3 SMART
ZnF_C2H2 435 457 1.45e-2 SMART
ZnF_C2H2 463 487 2.17e-1 SMART
ZnF_C2H2 493 515 2.91e-2 SMART
ZnF_C2H2 530 554 1.23e0 SMART
ZnF_C2H2 556 578 3.58e-2 SMART
ZnF_C2H2 584 606 1.62e0 SMART
ZnF_C2H2 612 634 2.27e-4 SMART
ZnF_C2H2 640 667 7.29e0 SMART
ZnF_C2H2 673 695 5.14e-3 SMART
low complexity region 733 752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153208
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
BC004004 G A 17: 29,282,275 probably benign Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E61G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Crhbp T C 13: 95,443,877 S65G probably benign Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glp2r T C 11: 67,664,516 probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Kcnj2 T C 11: 111,072,189 S136P probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lcp2 G T 11: 34,050,917 E33D probably benign Het
Lrrc32 G T 7: 98,498,937 R308L probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mfsd12 A G 10: 81,364,703 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Odf2 T A 2: 29,915,321 probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Prdm13 T C 4: 21,678,756 E578G probably benign Het
Pum3 A G 19: 27,422,716 I183T probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Stradb T C 1: 58,994,372 V398A probably benign Het
Tlr4 A T 4: 66,839,303 N111I probably damaging Het
Tnip2 G A 5: 34,503,581 R176* probably null Het
Tomm7 A G 5: 23,843,979 I32T probably benign Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zmym6 T C 4: 127,092,988 S154P probably damaging Het
Other mutations in Zfp341
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Zfp341 APN 2 154634231 missense probably damaging 1.00
IGL01352:Zfp341 APN 2 154628896 missense probably benign 0.00
IGL01748:Zfp341 APN 2 154628927 missense probably damaging 0.99
IGL02260:Zfp341 APN 2 154642049 missense possibly damaging 0.89
IGL02329:Zfp341 APN 2 154632304 missense possibly damaging 0.90
casanova_grimbacher UTSW 2 154624881 missense probably damaging 1.00
Specious UTSW 2 154646134 missense possibly damaging 0.63
R0079:Zfp341 UTSW 2 154624994 nonsense probably null
R0570:Zfp341 UTSW 2 154646068 missense probably benign 0.02
R0620:Zfp341 UTSW 2 154634273 missense possibly damaging 0.94
R1018:Zfp341 UTSW 2 154646052 missense probably damaging 1.00
R1611:Zfp341 UTSW 2 154645703 missense probably damaging 1.00
R1733:Zfp341 UTSW 2 154641378 missense probably benign 0.19
R1822:Zfp341 UTSW 2 154646134 missense possibly damaging 0.63
R1956:Zfp341 UTSW 2 154638212 missense probably benign 0.09
R2437:Zfp341 UTSW 2 154628801 missense probably damaging 0.97
R3623:Zfp341 UTSW 2 154624881 missense probably damaging 1.00
R4806:Zfp341 UTSW 2 154645866 utr 3 prime probably benign
R4807:Zfp341 UTSW 2 154645866 utr 3 prime probably benign
R4863:Zfp341 UTSW 2 154645866 utr 3 prime probably benign
R4955:Zfp341 UTSW 2 154638030 missense probably damaging 0.98
R4962:Zfp341 UTSW 2 154626814 missense possibly damaging 0.80
R5484:Zfp341 UTSW 2 154625001 missense probably benign 0.00
R5864:Zfp341 UTSW 2 154643554 missense possibly damaging 0.95
R5877:Zfp341 UTSW 2 154632289 missense probably damaging 1.00
R5975:Zfp341 UTSW 2 154630441 missense probably damaging 1.00
R5990:Zfp341 UTSW 2 154645659 missense probably damaging 0.98
R6057:Zfp341 UTSW 2 154625034 missense probably benign 0.01
R6882:Zfp341 UTSW 2 154638023 missense probably damaging 1.00
R7686:Zfp341 UTSW 2 154624861 missense probably damaging 0.96
R7701:Zfp341 UTSW 2 154634080 splice site probably null
R7847:Zfp341 UTSW 2 154634194 missense probably damaging 1.00
R8109:Zfp341 UTSW 2 154627900 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TAGGTACCAAGCCAGTGTGTG -3'
(R):5'- CGTCAAAGGATAGTCAGGGTTCC -3'

Sequencing Primer
(F):5'- TGGAGGCTCCAGTGTACC -3'
(R):5'- AGAAGGTGCCATCTAGACCTTCTG -3'
Posted On2015-07-07