Incidental Mutation 'R4417:Prdm13'
ID326872
Institutional Source Beutler Lab
Gene Symbol Prdm13
Ensembl Gene ENSMUSG00000040478
Gene NamePR domain containing 13
Synonyms
MMRRC Submission 041138-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4417 (G1)
Quality Score182
Status Validated
Chromosome4
Chromosomal Location21677480-21685963 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21678756 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 578 (E578G)
Ref Sequence ENSEMBL: ENSMUSP00000092761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076206] [ENSMUST00000095141]
Predicted Effect probably benign
Transcript: ENSMUST00000076206
AA Change: E530G

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075562
Gene: ENSMUSG00000040478
AA Change: E530G

DomainStartEndE-ValueType
Blast:SET 2 118 4e-72 BLAST
PDB:3EP0|B 56 132 1e-8 PDB
ZnF_C2H2 137 159 3.34e-2 SMART
low complexity region 204 220 N/A INTRINSIC
low complexity region 231 252 N/A INTRINSIC
low complexity region 267 275 N/A INTRINSIC
low complexity region 302 335 N/A INTRINSIC
low complexity region 336 350 N/A INTRINSIC
low complexity region 353 370 N/A INTRINSIC
low complexity region 392 404 N/A INTRINSIC
low complexity region 546 571 N/A INTRINSIC
ZnF_C2H2 572 594 4.4e-2 SMART
ZnF_C2H2 600 622 1.92e-2 SMART
ZnF_C2H2 629 652 2.79e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095141
AA Change: E578G

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092761
Gene: ENSMUSG00000040478
AA Change: E578G

DomainStartEndE-ValueType
Blast:SET 42 166 1e-73 BLAST
PDB:3EP0|B 104 180 1e-8 PDB
ZnF_C2H2 185 207 3.34e-2 SMART
low complexity region 252 268 N/A INTRINSIC
low complexity region 279 300 N/A INTRINSIC
low complexity region 315 323 N/A INTRINSIC
low complexity region 350 383 N/A INTRINSIC
low complexity region 384 398 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
low complexity region 594 619 N/A INTRINSIC
ZnF_C2H2 620 642 4.4e-2 SMART
ZnF_C2H2 648 670 1.92e-2 SMART
ZnF_C2H2 677 700 2.79e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149516
Meta Mutation Damage Score 0.0810 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show a specific reduction in the number of GABAergic and glycinergic amacrine cells, a thin retinal inner nuclear layer, altered retinal inner plexiform layer morphology, and abnormally increased spatial, temporal, and contrast sensitivities in optokinetic reponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
BC004004 G A 17: 29,282,275 probably benign Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E61G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Crhbp T C 13: 95,443,877 S65G probably benign Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glp2r T C 11: 67,664,516 probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Kcnj2 T C 11: 111,072,189 S136P probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lcp2 G T 11: 34,050,917 E33D probably benign Het
Lrrc32 G T 7: 98,498,937 R308L probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mfsd12 A G 10: 81,364,703 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Odf2 T A 2: 29,915,321 probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Pum3 A G 19: 27,422,716 I183T probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Stradb T C 1: 58,994,372 V398A probably benign Het
Tlr4 A T 4: 66,839,303 N111I probably damaging Het
Tnip2 G A 5: 34,503,581 R176* probably null Het
Tomm7 A G 5: 23,843,979 I32T probably benign Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zfp341 T C 2: 154,628,987 L308P possibly damaging Het
Zmym6 T C 4: 127,092,988 S154P probably damaging Het
Other mutations in Prdm13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02940:Prdm13 APN 4 21683421 nonsense probably null
IGL03211:Prdm13 APN 4 21678492 missense probably damaging 1.00
R0363:Prdm13 UTSW 4 21679737 missense unknown
R0512:Prdm13 UTSW 4 21678490 missense probably damaging 1.00
R0726:Prdm13 UTSW 4 21683914 missense unknown
R1056:Prdm13 UTSW 4 21678544 missense probably damaging 1.00
R1433:Prdm13 UTSW 4 21678909 missense probably damaging 1.00
R2005:Prdm13 UTSW 4 21685695 utr 5 prime probably benign
R2292:Prdm13 UTSW 4 21683914 missense unknown
R2382:Prdm13 UTSW 4 21678277 missense possibly damaging 0.73
R3620:Prdm13 UTSW 4 21683532 missense unknown
R4039:Prdm13 UTSW 4 21685774 utr 5 prime probably benign
R4453:Prdm13 UTSW 4 21679464 missense unknown
R4850:Prdm13 UTSW 4 21678243 missense possibly damaging 0.92
R4864:Prdm13 UTSW 4 21685543 missense unknown
R4934:Prdm13 UTSW 4 21678223 utr 3 prime probably benign
R5138:Prdm13 UTSW 4 21679507 missense unknown
R5304:Prdm13 UTSW 4 21678984 missense probably damaging 1.00
R5394:Prdm13 UTSW 4 21679455 missense unknown
R5909:Prdm13 UTSW 4 21683894 missense unknown
R5964:Prdm13 UTSW 4 21683852 nonsense probably null
R6261:Prdm13 UTSW 4 21678366 missense probably damaging 1.00
R7166:Prdm13 UTSW 4 21683528 missense unknown
R7175:Prdm13 UTSW 4 21679473 missense unknown
R7549:Prdm13 UTSW 4 21679072 missense probably damaging 1.00
Z1176:Prdm13 UTSW 4 21679518 missense unknown
Z1177:Prdm13 UTSW 4 21679623 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCACTTGAGCGGCTTGTAG -3'
(R):5'- ATTACCCTCTCAAGCTGCAC -3'

Sequencing Primer
(F):5'- CATGTGGATCTTGAGCCCGTAC -3'
(R):5'- AAGCTGCACTTGGGCGG -3'
Posted On2015-07-07