Incidental Mutation 'R4417:Zmym6'
ID326875
Institutional Source Beutler Lab
Gene Symbol Zmym6
Ensembl Gene ENSMUSG00000042408
Gene Namezinc finger, MYM-type 6
SynonymsZfp258, D4Wsu24e, 9330177P20Rik
MMRRC Submission 041138-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4417 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location127077383-127124372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127092988 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 154 (S154P)
Ref Sequence ENSEMBL: ENSMUSP00000045366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046751] [ENSMUST00000094713]
Predicted Effect probably damaging
Transcript: ENSMUST00000046751
AA Change: S154P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045366
Gene: ENSMUSG00000042408
AA Change: S154P

DomainStartEndE-ValueType
Blast:TRASH 77 113 1e-12 BLAST
TRASH 123 163 1.18e-1 SMART
TRASH 197 231 5.47e3 SMART
TRASH 241 277 4.01e1 SMART
TRASH 349 385 2.46e1 SMART
TRASH 391 426 3.32e2 SMART
TRASH 434 472 2.91e-1 SMART
TRASH 478 513 9.99e0 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 642 656 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094713
AA Change: S154P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092303
Gene: ENSMUSG00000042408
AA Change: S154P

DomainStartEndE-ValueType
Blast:TRASH 77 113 1e-12 BLAST
TRASH 123 163 1.18e-1 SMART
TRASH 197 231 5.47e3 SMART
TRASH 262 293 6.03e2 SMART
TRASH 299 334 3.32e2 SMART
TRASH 342 380 2.91e-1 SMART
TRASH 386 421 9.99e0 SMART
low complexity region 510 520 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151461
Meta Mutation Damage Score 0.4970 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
BC004004 G A 17: 29,282,275 probably benign Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E61G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Crhbp T C 13: 95,443,877 S65G probably benign Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glp2r T C 11: 67,664,516 probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Kcnj2 T C 11: 111,072,189 S136P probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lcp2 G T 11: 34,050,917 E33D probably benign Het
Lrrc32 G T 7: 98,498,937 R308L probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mfsd12 A G 10: 81,364,703 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Odf2 T A 2: 29,915,321 probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Prdm13 T C 4: 21,678,756 E578G probably benign Het
Pum3 A G 19: 27,422,716 I183T probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Stradb T C 1: 58,994,372 V398A probably benign Het
Tlr4 A T 4: 66,839,303 N111I probably damaging Het
Tnip2 G A 5: 34,503,581 R176* probably null Het
Tomm7 A G 5: 23,843,979 I32T probably benign Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zfp341 T C 2: 154,628,987 L308P possibly damaging Het
Other mutations in Zmym6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Zmym6 APN 4 127101949 nonsense probably null
IGL00486:Zmym6 APN 4 127124185 utr 5 prime probably benign
IGL01017:Zmym6 APN 4 127088359 missense probably benign 0.00
IGL01385:Zmym6 APN 4 127124106 missense probably benign 0.02
IGL01577:Zmym6 APN 4 127105430 missense probably damaging 1.00
IGL01654:Zmym6 APN 4 127123726 missense probably damaging 1.00
IGL01736:Zmym6 APN 4 127108644 missense probably damaging 1.00
IGL01824:Zmym6 APN 4 127108706 missense probably damaging 0.99
IGL01916:Zmym6 APN 4 127123756 missense probably damaging 0.98
IGL01985:Zmym6 APN 4 127100748 missense probably damaging 1.00
IGL02056:Zmym6 APN 4 127103414 missense probably damaging 1.00
IGL02477:Zmym6 APN 4 127078502 nonsense probably null
IGL02754:Zmym6 APN 4 127109971 splice site probably benign
IGL03344:Zmym6 APN 4 127120521 missense probably damaging 1.00
IGL03412:Zmym6 APN 4 127092938 missense probably damaging 1.00
R0335:Zmym6 UTSW 4 127122808 missense probably damaging 1.00
R0448:Zmym6 UTSW 4 127108694 missense probably benign 0.01
R0463:Zmym6 UTSW 4 127122772 missense probably damaging 0.98
R0538:Zmym6 UTSW 4 127123369 missense probably benign 0.21
R0789:Zmym6 UTSW 4 127122822 missense possibly damaging 0.52
R0798:Zmym6 UTSW 4 127103523 missense probably benign 0.00
R1311:Zmym6 UTSW 4 127123358 missense probably damaging 1.00
R1351:Zmym6 UTSW 4 127123005 missense probably benign 0.00
R1429:Zmym6 UTSW 4 127123879 missense probably damaging 1.00
R1636:Zmym6 UTSW 4 127123767 missense probably damaging 0.99
R1666:Zmym6 UTSW 4 127122859 missense probably damaging 0.98
R1919:Zmym6 UTSW 4 127103414 missense probably damaging 1.00
R2058:Zmym6 UTSW 4 127088415 nonsense probably null
R3957:Zmym6 UTSW 4 127123296 missense possibly damaging 0.68
R3978:Zmym6 UTSW 4 127123555 missense possibly damaging 0.71
R4801:Zmym6 UTSW 4 127123216 missense probably benign 0.19
R4802:Zmym6 UTSW 4 127123216 missense probably benign 0.19
R5052:Zmym6 UTSW 4 127123974 missense possibly damaging 0.92
R5105:Zmym6 UTSW 4 127123758 missense probably benign 0.33
R5217:Zmym6 UTSW 4 127105374 missense possibly damaging 0.76
R5682:Zmym6 UTSW 4 127104407 missense probably damaging 1.00
R5841:Zmym6 UTSW 4 127100670 missense possibly damaging 0.71
R5991:Zmym6 UTSW 4 127108473 intron probably null
R6478:Zmym6 UTSW 4 127123383 missense possibly damaging 0.86
R7014:Zmym6 UTSW 4 127123544 nonsense probably null
R7287:Zmym6 UTSW 4 127122982 missense possibly damaging 0.50
R7290:Zmym6 UTSW 4 127123501 missense possibly damaging 0.73
R7371:Zmym6 UTSW 4 127104313 missense probably damaging 1.00
X0025:Zmym6 UTSW 4 127122350 missense possibly damaging 0.60
X0067:Zmym6 UTSW 4 127104314 missense probably damaging 1.00
Z1177:Zmym6 UTSW 4 127123797 missense not run
Predicted Primers PCR Primer
(F):5'- GGTTTTCTACTGTGCAATAGTTACTCC -3'
(R):5'- TGCACTGGGGAGACTGAAAC -3'

Sequencing Primer
(F):5'- CCAGTAAAATAGCATTTTAGCTCCC -3'
(R):5'- TTGAGACCAGTCTAGAATACAGAGC -3'
Posted On2015-07-07