Incidental Mutation 'R4417:Tomm7'
ID326876
Institutional Source Beutler Lab
Gene Symbol Tomm7
Ensembl Gene ENSMUSG00000028998
Gene Nametranslocase of outer mitochondrial membrane 7
Synonyms1110020J08Rik, TOM7
MMRRC Submission 041138-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R4417 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location23838944-23844161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23843979 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 32 (I32T)
Ref Sequence ENSEMBL: ENSMUSP00000030851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030851]
Predicted Effect probably benign
Transcript: ENSMUST00000030851
AA Change: I32T

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030851
Gene: ENSMUSG00000028998
AA Change: I32T

DomainStartEndE-ValueType
Pfam:Tom7 9 53 5.3e-19 PFAM
Meta Mutation Damage Score 0.4879 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the translocase of the outer mitochondrial membrane. The encoded protein regulates the assembly and stability of the translocase complex. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
BC004004 G A 17: 29,282,275 probably benign Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E61G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Crhbp T C 13: 95,443,877 S65G probably benign Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glp2r T C 11: 67,664,516 probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Kcnj2 T C 11: 111,072,189 S136P probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lcp2 G T 11: 34,050,917 E33D probably benign Het
Lrrc32 G T 7: 98,498,937 R308L probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mfsd12 A G 10: 81,364,703 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Odf2 T A 2: 29,915,321 probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Prdm13 T C 4: 21,678,756 E578G probably benign Het
Pum3 A G 19: 27,422,716 I183T probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Stradb T C 1: 58,994,372 V398A probably benign Het
Tlr4 A T 4: 66,839,303 N111I probably damaging Het
Tnip2 G A 5: 34,503,581 R176* probably null Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zfp341 T C 2: 154,628,987 L308P possibly damaging Het
Zmym6 T C 4: 127,092,988 S154P probably damaging Het
Other mutations in Tomm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0894:Tomm7 UTSW 5 23844027 missense probably damaging 1.00
R1795:Tomm7 UTSW 5 23844027 missense probably damaging 1.00
R5133:Tomm7 UTSW 5 23844006 missense probably benign 0.07
R6364:Tomm7 UTSW 5 23844030 missense probably damaging 0.99
R7213:Tomm7 UTSW 5 23844061 missense possibly damaging 0.93
R7444:Tomm7 UTSW 5 23844157 start gained probably benign
R8829:Tomm7 UTSW 5 23844049 missense possibly damaging 0.71
R8832:Tomm7 UTSW 5 23844049 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GTGTGACTGGTTAAACACTACTC -3'
(R):5'- TCACGACTCCTGCCGTAAAG -3'

Sequencing Primer
(F):5'- GACTGGTTAAACACTACTCAAATAGC -3'
(R):5'- TAAAGGCCCCACGTGGC -3'
Posted On2015-07-07