Incidental Mutation 'R4417:Tnip2'
ID326877
Institutional Source Beutler Lab
Gene Symbol Tnip2
Ensembl Gene ENSMUSG00000059866
Gene NameTNFAIP3 interacting protein 2
SynonymsABIN-2, 1810020H16Rik
MMRRC Submission 041138-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R4417 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location34496087-34513991 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 34503581 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 176 (R176*)
Ref Sequence ENSEMBL: ENSMUSP00000109999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030991] [ENSMUST00000087737] [ENSMUST00000114359]
Predicted Effect probably null
Transcript: ENSMUST00000030991
AA Change: R176*
SMART Domains Protein: ENSMUSP00000030991
Gene: ENSMUSG00000059866
AA Change: R176*

DomainStartEndE-ValueType
coiled coil region 30 123 N/A INTRINSIC
Pfam:EABR 236 269 7.2e-21 PFAM
Pfam:CC2-LZ 264 364 5.5e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000087737
AA Change: R176*
SMART Domains Protein: ENSMUSP00000085030
Gene: ENSMUSG00000059866
AA Change: R176*

DomainStartEndE-ValueType
coiled coil region 30 123 N/A INTRINSIC
Pfam:EABR 215 249 4.9e-23 PFAM
coiled coil region 256 341 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114359
AA Change: R176*
SMART Domains Protein: ENSMUSP00000109999
Gene: ENSMUSG00000059866
AA Change: R176*

DomainStartEndE-ValueType
coiled coil region 30 123 N/A INTRINSIC
coiled coil region 225 258 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144791
AA Change: T209M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159102
Meta Mutation Damage Score 0.9653 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which acts as an inhibitor of NFkappaB activation. The encoded protein is also involved in MAP/ERK signaling pathway in specific cell types. It may be involved in apoptosis of endothelial cells. Alternative splicing results in multiple transcript variants. A pseudogene related to this gene is located on the X chromosome.[provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele have impaired IL-1 response and macrophage physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
BC004004 G A 17: 29,282,275 probably benign Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E61G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Crhbp T C 13: 95,443,877 S65G probably benign Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glp2r T C 11: 67,664,516 probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Kcnj2 T C 11: 111,072,189 S136P probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lcp2 G T 11: 34,050,917 E33D probably benign Het
Lrrc32 G T 7: 98,498,937 R308L probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mfsd12 A G 10: 81,364,703 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Odf2 T A 2: 29,915,321 probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Prdm13 T C 4: 21,678,756 E578G probably benign Het
Pum3 A G 19: 27,422,716 I183T probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Stradb T C 1: 58,994,372 V398A probably benign Het
Tlr4 A T 4: 66,839,303 N111I probably damaging Het
Tomm7 A G 5: 23,843,979 I32T probably benign Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zfp341 T C 2: 154,628,987 L308P possibly damaging Het
Zmym6 T C 4: 127,092,988 S154P probably damaging Het
Other mutations in Tnip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Tnip2 APN 5 34499299 missense probably benign 0.29
IGL01980:Tnip2 APN 5 34496868 missense probably benign 0.17
IGL02649:Tnip2 APN 5 34513731 missense probably damaging 1.00
IGL03122:Tnip2 APN 5 34503751 missense possibly damaging 0.94
PIT4445001:Tnip2 UTSW 5 34496871 missense probably benign 0.41
R1713:Tnip2 UTSW 5 34503831 splice site probably benign
R1782:Tnip2 UTSW 5 34499668 missense probably benign 0.21
R2183:Tnip2 UTSW 5 34499613 intron probably benign
R2184:Tnip2 UTSW 5 34499613 intron probably benign
R5216:Tnip2 UTSW 5 34503805 missense probably damaging 0.99
R5254:Tnip2 UTSW 5 34503578 missense probably damaging 0.99
R5287:Tnip2 UTSW 5 34513764 missense probably damaging 1.00
R5403:Tnip2 UTSW 5 34513764 missense probably damaging 1.00
R5839:Tnip2 UTSW 5 34496632 utr 3 prime probably benign
R6355:Tnip2 UTSW 5 34499197 nonsense probably null
R6379:Tnip2 UTSW 5 34503635 missense probably damaging 1.00
R7389:Tnip2 UTSW 5 34513801 missense probably benign 0.04
R8224:Tnip2 UTSW 5 34513659 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AGGTCACATGTTCCACCAGATC -3'
(R):5'- AGATGCAACAGCTGATGAGC -3'

Sequencing Primer
(F):5'- ACCAGATCTCTCCTGCTAAGC -3'
(R):5'- TGAGCCAGCCTCAGCATGAG -3'
Posted On2015-07-07