Mutagenetix > Incidental Mutation

Incidental Mutation 'R4417:Pitpnm2'

326880

Institutional Source

Beutler Lab

Gene Symbol

Pitpnm2

Ensembl Gene

ENSMUSG00000029406

Gene Name

phosphatidylinositol transfer protein, membrane-associated 2

Synonyms

NIR3, RDGBA2, Rdgb2

MMRRC Submission

041138-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4417 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124118690-124249760 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 124123569 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 977 (R977S)

Ref Sequence

ENSEMBL: ENSMUSP00000124111 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086123] [ENSMUST00000161273] [ENSMUST00000161938] [ENSMUST00000162812]

AlphaFold

Q6ZPQ6

Predicted Effect

probably damaging
Transcript: ENSMUST00000086123
AA Change: R923S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000083292
Gene: ENSMUSG00000029406
AA Change: R923S

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	253	6.1e-132	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
low complexity region	507	515	N/A	INTRINSIC
Blast:DDHD	548	570	6e-7	BLAST
low complexity region	571	589	N/A	INTRINSIC
low complexity region	608	630	N/A	INTRINSIC
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	895	1.66e-98	SMART
LNS2	1040	1171	3.22e-55	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159010

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159628

Predicted Effect

probably damaging
Transcript: ENSMUST00000161273
AA Change: R973S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124292
Gene: ENSMUSG00000029406
AA Change: R973S

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	253	3.2e-129	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
Blast:DDHD	422	670	2e-65	BLAST
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	945	7.5e-100	SMART
LNS2	1090	1221	3.1e-59	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161479

Predicted Effect

probably damaging
Transcript: ENSMUST00000161938
AA Change: R977S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124111
Gene: ENSMUSG00000029406
AA Change: R977S

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	251	7.5e-116	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
Blast:DDHD	422	670	2e-65	BLAST
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	949	8.37e-104	SMART
LNS2	1094	1225	3.22e-55	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000162812
AA Change: R923S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124740
Gene: ENSMUSG00000029406
AA Change: R923S

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	253	6.1e-132	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
low complexity region	507	515	N/A	INTRINSIC
Blast:DDHD	548	570	6e-7	BLAST
low complexity region	571	589	N/A	INTRINSIC
low complexity region	608	630	N/A	INTRINSIC
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	895	1.66e-98	SMART
LNS2	1040	1171	3.22e-55	SMART

Meta Mutation Damage Score

0.2608

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PITPNM2 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no defects pertaining to photoreceptor function or survival. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
A630001G21Rik	T	A	1: 85,726,463	Y51F	probably damaging	Het
Abi3bp	C	A	16: 56,654,035	T631K	probably damaging	Het
BC004004	G	A	17: 29,282,275		probably benign	Het
Cabp1	G	A	5: 115,186,037	S7L	possibly damaging	Het
Cdc23	ACC	AC	18: 34,637,318		probably null	Het
Clhc1	T	C	11: 29,571,826	I453T	possibly damaging	Het
Col28a1	T	A	6: 8,175,666	I61F	possibly damaging	Het
Col2a1	T	C	15: 97,998,585	E61G	unknown	Het
Col6a4	C	T	9: 106,072,016	V807I	probably damaging	Het
Crhbp	T	C	13: 95,443,877	S65G	probably benign	Het
Dnah9	T	A	11: 65,981,214	Q2730L	possibly damaging	Het
Epx	T	A	11: 87,869,430	R453*	probably null	Het
Fez1	T	C	9: 36,870,472		probably benign	Het
G530012D18Rik	G	C	1: 85,577,202		probably benign	Het
Glp2r	T	C	11: 67,664,516		probably benign	Het
Gm1141	G	A	X: 71,939,619	C399Y	possibly damaging	Het
Gpm6a	T	A	8: 55,050,188	N157K	probably damaging	Het
Kcnj2	T	C	11: 111,072,189	S136P	probably damaging	Het
Lad1	A	G	1: 135,828,746	D364G	probably benign	Het
Lcp2	G	T	11: 34,050,917	E33D	probably benign	Het
Lrrc32	G	T	7: 98,498,937	R308L	probably benign	Het
Matr3	C	A	18: 35,572,118	A32D	probably damaging	Het
Mfsd12	A	G	10: 81,364,703		probably benign	Het
Mtmr11	T	C	3: 96,167,891		probably benign	Het
Notch2	A	G	3: 98,131,270	D1243G	possibly damaging	Het
Odf2	T	A	2: 29,915,321		probably benign	Het
Oit3	T	C	10: 59,428,103	Y403C	probably damaging	Het
Olfr1233	T	C	2: 89,339,987	E105G	probably benign	Het
Prdm13	T	C	4: 21,678,756	E578G	probably benign	Het
Pum3	A	G	19: 27,422,716	I183T	probably damaging	Het
Rdh14	G	A	12: 10,391,231		probably null	Het
Slc35b2	G	A	17: 45,566,429	V161M	probably benign	Het
Slit1	A	G	19: 41,614,469	C968R	probably damaging	Het
Spag9	A	T	11: 94,060,346		probably benign	Het
Stox1	T	C	10: 62,659,569	N975S	probably benign	Het
Stradb	T	C	1: 58,994,372	V398A	probably benign	Het
Tlr4	A	T	4: 66,839,303	N111I	probably damaging	Het
Tnip2	G	A	5: 34,503,581	R176*	probably null	Het
Tomm7	A	G	5: 23,843,979	I32T	probably benign	Het
Trank1	T	C	9: 111,365,968	I1020T	probably benign	Het
Ugt1a10	T	G	1: 88,055,995	S172A	probably benign	Het
Vmn2r115	T	A	17: 23,345,880	M247K	probably benign	Het
Zfp341	T	C	2: 154,628,987	L308P	possibly damaging	Het
Zmym6	T	C	4: 127,092,988	S154P	probably damaging	Het

Other mutations in Pitpnm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00930:Pitpnm2	APN	5	124121663	unclassified	probably benign
IGL01660:Pitpnm2	APN	5	124123194	missense	probably damaging	1.00
IGL02328:Pitpnm2	APN	5	124121414	missense	probably damaging	0.99
IGL02340:Pitpnm2	APN	5	124130613	missense	probably damaging	1.00
IGL02399:Pitpnm2	APN	5	124140758	splice site	probably benign
IGL02719:Pitpnm2	APN	5	124140602	missense	probably damaging	1.00
IGL03053:Pitpnm2	APN	5	124143601	missense	probably damaging	1.00
IGL03083:Pitpnm2	APN	5	124133382	missense	possibly damaging	0.92
PIT4131001:Pitpnm2	UTSW	5	124131115	missense	probably benign	0.01
R0058:Pitpnm2	UTSW	5	124124030	missense	probably damaging	1.00
R0437:Pitpnm2	UTSW	5	124131089	splice site	probably benign
R0530:Pitpnm2	UTSW	5	124131201	missense	probably damaging	1.00
R0568:Pitpnm2	UTSW	5	124140517	splice site	probably benign
R0926:Pitpnm2	UTSW	5	124131209	missense	probably benign	0.10
R1625:Pitpnm2	UTSW	5	124133433	missense	probably benign	0.05
R2008:Pitpnm2	UTSW	5	124152621	start codon destroyed	probably damaging	0.99
R2120:Pitpnm2	UTSW	5	124127269	missense	probably damaging	1.00
R2354:Pitpnm2	UTSW	5	124122919	missense	probably damaging	0.99
R2448:Pitpnm2	UTSW	5	124123994	missense	probably damaging	1.00
R2509:Pitpnm2	UTSW	5	124136326	missense	probably damaging	0.99
R2510:Pitpnm2	UTSW	5	124136326	missense	probably damaging	0.99
R2511:Pitpnm2	UTSW	5	124136326	missense	probably damaging	0.99
R2520:Pitpnm2	UTSW	5	124129401	missense	probably damaging	0.96
R2860:Pitpnm2	UTSW	5	124121437	missense	probably damaging	1.00
R2861:Pitpnm2	UTSW	5	124121437	missense	probably damaging	1.00
R4407:Pitpnm2	UTSW	5	124152615	missense	possibly damaging	0.57
R4426:Pitpnm2	UTSW	5	124142123	missense	probably benign	0.32
R4458:Pitpnm2	UTSW	5	124121376	missense	probably benign	0.00
R4610:Pitpnm2	UTSW	5	124125371	missense	probably damaging	0.99
R4786:Pitpnm2	UTSW	5	124121743	nonsense	probably null
R4903:Pitpnm2	UTSW	5	124152605	missense	probably damaging	1.00
R5151:Pitpnm2	UTSW	5	124136386	missense	probably damaging	1.00
R5315:Pitpnm2	UTSW	5	124121933	missense	probably benign	0.18
R5592:Pitpnm2	UTSW	5	124142149	missense	probably damaging	1.00
R5792:Pitpnm2	UTSW	5	124130321	nonsense	probably null
R6846:Pitpnm2	UTSW	5	124131171	missense	probably benign	0.00
R6983:Pitpnm2	UTSW	5	124133406	missense	probably damaging	1.00
R7096:Pitpnm2	UTSW	5	124129261	missense	possibly damaging	0.69
R7188:Pitpnm2	UTSW	5	124121303	missense	probably benign	0.31
R7203:Pitpnm2	UTSW	5	124121459	missense	probably damaging	0.96
R7237:Pitpnm2	UTSW	5	124125297	critical splice donor site	probably null
R7257:Pitpnm2	UTSW	5	124125356	missense	possibly damaging	0.88
R7622:Pitpnm2	UTSW	5	124122027	missense	probably benign	0.39
R7677:Pitpnm2	UTSW	5	124123569	missense	probably damaging	1.00
R7736:Pitpnm2	UTSW	5	124123030	missense	possibly damaging	0.47
R7745:Pitpnm2	UTSW	5	124128705	missense	probably benign	0.19
R8041:Pitpnm2	UTSW	5	124121456	missense	probably damaging	1.00
R9070:Pitpnm2	UTSW	5	124121312	missense	probably damaging	1.00
R9218:Pitpnm2	UTSW	5	124127281	missense	probably damaging	0.97
R9423:Pitpnm2	UTSW	5	124133406	missense	probably benign	0.05
R9438:Pitpnm2	UTSW	5	124131279	missense	probably damaging	0.99
R9439:Pitpnm2	UTSW	5	124136126	missense	probably damaging	1.00
R9439:Pitpnm2	UTSW	5	124140596	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACTTAGTCAGGCCAGGCAG -3'
(R):5'- TGATAATCCTGCCGACCCTG -3'

Sequencing Primer
(F):5'- CAGAGAGGGAGCCATCCTTG -3'
(R):5'- TGCCAGGTGCTCACTGC -3'

Posted On

2015-07-07