Mutagenetix > Incidental Mutation

Incidental Mutation 'R4417:Col28a1'

326881

Institutional Source

Beutler Lab

Gene Symbol

Col28a1

Ensembl Gene

ENSMUSG00000068794

Gene Name

collagen, type XXVIII, alpha 1

Synonyms

Col28; Gm466

MMRRC Submission

041138-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R4417 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

7997808-8192617 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 8175666 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 61 (I61F)

Ref Sequence

ENSEMBL: ENSMUSP00000150110 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115537] [ENSMUST00000213284]

AlphaFold

Q2UY11

Predicted Effect

unknown
Transcript: ENSMUST00000115537
AA Change: I61F

SMART Domains

Protein: ENSMUSP00000111199
Gene: ENSMUSG00000068794
AA Change: I61F

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
VWA	46	225	8.08e-18	SMART
low complexity region	245	260	N/A	INTRINSIC
internal_repeat_1	261	304	1.56e-15	PROSPERO
low complexity region	306	363	N/A	INTRINSIC
low complexity region	375	422	N/A	INTRINSIC
low complexity region	438	479	N/A	INTRINSIC
internal_repeat_4	481	531	4.11e-8	PROSPERO
Pfam:Collagen	534	591	1.5e-8	PFAM
low complexity region	640	661	N/A	INTRINSIC
low complexity region	667	684	N/A	INTRINSIC
internal_repeat_4	690	739	4.11e-8	PROSPERO
internal_repeat_1	711	763	1.56e-15	PROSPERO
internal_repeat_5	713	769	4.35e-6	PROSPERO
low complexity region	771	789	N/A	INTRINSIC
VWA	796	973	1.57e-38	SMART
KU	1086	1139	8.16e-20	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213284
AA Change: I61F

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)

Meta Mutation Damage Score

0.0851

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL28A1 belongs to a class of collagens containing von Willebrand factor (VWF; MIM 613160) type A (VWFA) domains (Veit et al., 2006 [PubMed 16330543]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
A630001G21Rik	T	A	1: 85,726,463	Y51F	probably damaging	Het
Abi3bp	C	A	16: 56,654,035	T631K	probably damaging	Het
BC004004	G	A	17: 29,282,275		probably benign	Het
Cabp1	G	A	5: 115,186,037	S7L	possibly damaging	Het
Cdc23	ACC	AC	18: 34,637,318		probably null	Het
Clhc1	T	C	11: 29,571,826	I453T	possibly damaging	Het
Col2a1	T	C	15: 97,998,585	E61G	unknown	Het
Col6a4	C	T	9: 106,072,016	V807I	probably damaging	Het
Crhbp	T	C	13: 95,443,877	S65G	probably benign	Het
Dnah9	T	A	11: 65,981,214	Q2730L	possibly damaging	Het
Epx	T	A	11: 87,869,430	R453*	probably null	Het
Fez1	T	C	9: 36,870,472		probably benign	Het
G530012D18Rik	G	C	1: 85,577,202		probably benign	Het
Glp2r	T	C	11: 67,664,516		probably benign	Het
Gm1141	G	A	X: 71,939,619	C399Y	possibly damaging	Het
Gpm6a	T	A	8: 55,050,188	N157K	probably damaging	Het
Kcnj2	T	C	11: 111,072,189	S136P	probably damaging	Het
Lad1	A	G	1: 135,828,746	D364G	probably benign	Het
Lcp2	G	T	11: 34,050,917	E33D	probably benign	Het
Lrrc32	G	T	7: 98,498,937	R308L	probably benign	Het
Matr3	C	A	18: 35,572,118	A32D	probably damaging	Het
Mfsd12	A	G	10: 81,364,703		probably benign	Het
Mtmr11	T	C	3: 96,167,891		probably benign	Het
Notch2	A	G	3: 98,131,270	D1243G	possibly damaging	Het
Odf2	T	A	2: 29,915,321		probably benign	Het
Oit3	T	C	10: 59,428,103	Y403C	probably damaging	Het
Olfr1233	T	C	2: 89,339,987	E105G	probably benign	Het
Pitpnm2	G	T	5: 124,123,569	R977S	probably damaging	Het
Prdm13	T	C	4: 21,678,756	E578G	probably benign	Het
Pum3	A	G	19: 27,422,716	I183T	probably damaging	Het
Rdh14	G	A	12: 10,391,231		probably null	Het
Slc35b2	G	A	17: 45,566,429	V161M	probably benign	Het
Slit1	A	G	19: 41,614,469	C968R	probably damaging	Het
Spag9	A	T	11: 94,060,346		probably benign	Het
Stox1	T	C	10: 62,659,569	N975S	probably benign	Het
Stradb	T	C	1: 58,994,372	V398A	probably benign	Het
Tlr4	A	T	4: 66,839,303	N111I	probably damaging	Het
Tnip2	G	A	5: 34,503,581	R176*	probably null	Het
Tomm7	A	G	5: 23,843,979	I32T	probably benign	Het
Trank1	T	C	9: 111,365,968	I1020T	probably benign	Het
Ugt1a10	T	G	1: 88,055,995	S172A	probably benign	Het
Vmn2r115	T	A	17: 23,345,880	M247K	probably benign	Het
Zfp341	T	C	2: 154,628,987	L308P	possibly damaging	Het
Zmym6	T	C	4: 127,092,988	S154P	probably damaging	Het

Other mutations in Col28a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Col28a1	APN	6	8014795	missense	probably damaging	1.00
IGL00329:Col28a1	APN	6	8175425	missense	probably damaging	1.00
IGL00466:Col28a1	APN	6	8022081	splice site	probably benign
IGL00544:Col28a1	APN	6	8162228	critical splice acceptor site	probably null
IGL00979:Col28a1	APN	6	8014810	missense	probably damaging	1.00
IGL01475:Col28a1	APN	6	8103521	missense	probably damaging	0.98
IGL01570:Col28a1	APN	6	8014540	missense	probably damaging	0.99
IGL01688:Col28a1	APN	6	7998517	missense	probably damaging	1.00
IGL01734:Col28a1	APN	6	8158134	missense	probably damaging	0.99
IGL01911:Col28a1	APN	6	8014963	missense	probably damaging	1.00
IGL01922:Col28a1	APN	6	8158133	missense	probably damaging	0.96
IGL02567:Col28a1	APN	6	8014819	missense	possibly damaging	0.91
IGL02641:Col28a1	APN	6	8014794	nonsense	probably null
IGL02893:Col28a1	APN	6	8103534	missense	probably damaging	1.00
IGL03062:Col28a1	APN	6	8017029	splice site	probably benign
IGL03273:Col28a1	APN	6	8103484	splice site	probably benign
P0043:Col28a1	UTSW	6	8168152	unclassified	probably benign
R0034:Col28a1	UTSW	6	8175708	missense	probably benign	0.32
R0543:Col28a1	UTSW	6	8075326	splice site	probably benign
R0646:Col28a1	UTSW	6	8175291	missense	possibly damaging	0.88
R0726:Col28a1	UTSW	6	8014495	critical splice donor site	probably null
R1013:Col28a1	UTSW	6	7999452	splice site	probably benign
R1054:Col28a1	UTSW	6	8175534	missense	probably damaging	0.96
R1671:Col28a1	UTSW	6	8083773	missense	possibly damaging	0.84
R1804:Col28a1	UTSW	6	8164612	critical splice donor site	probably null
R1853:Col28a1	UTSW	6	8014574	missense	probably benign	0.03
R1906:Col28a1	UTSW	6	7999644	missense	probably benign	0.14
R1914:Col28a1	UTSW	6	8176333	missense	probably benign	0.08
R1915:Col28a1	UTSW	6	8176333	missense	probably benign	0.08
R1954:Col28a1	UTSW	6	7998516	missense	probably damaging	1.00
R1997:Col28a1	UTSW	6	7999644	missense	probably benign	0.14
R2011:Col28a1	UTSW	6	8059360	missense	probably benign	0.05
R2023:Col28a1	UTSW	6	8083783	missense	possibly damaging	0.66
R2149:Col28a1	UTSW	6	8155383	missense	possibly damaging	0.83
R2285:Col28a1	UTSW	6	8097078	missense	probably damaging	0.98
R2403:Col28a1	UTSW	6	8175641	missense	possibly damaging	0.79
R3615:Col28a1	UTSW	6	8014942	missense	probably damaging	1.00
R3616:Col28a1	UTSW	6	8014942	missense	probably damaging	1.00
R3837:Col28a1	UTSW	6	8014601	missense	possibly damaging	0.81
R4042:Col28a1	UTSW	6	8014678	missense	probably damaging	0.98
R4084:Col28a1	UTSW	6	8013131	nonsense	probably null
R4084:Col28a1	UTSW	6	8013132	missense	possibly damaging	0.49
R4838:Col28a1	UTSW	6	8014559	missense	probably benign	0.11
R5752:Col28a1	UTSW	6	8015025	missense	possibly damaging	0.79
R5807:Col28a1	UTSW	6	8158144	missense	probably benign	0.00
R6038:Col28a1	UTSW	6	8013140	missense	probably benign	0.03
R6038:Col28a1	UTSW	6	8013140	missense	probably benign	0.03
R6046:Col28a1	UTSW	6	8168102	splice site	probably null
R6054:Col28a1	UTSW	6	8083748	missense	possibly damaging	0.96
R6159:Col28a1	UTSW	6	8162247	splice site	probably null
R6306:Col28a1	UTSW	6	8014969	missense	probably damaging	0.96
R6379:Col28a1	UTSW	6	8012996	missense	probably benign	0.00
R6665:Col28a1	UTSW	6	8062277	missense	probably benign	0.08
R6809:Col28a1	UTSW	6	7999468	missense	probably damaging	0.99
R7023:Col28a1	UTSW	6	8083763	missense	possibly damaging	0.92
R7101:Col28a1	UTSW	6	8014795	missense	possibly damaging	0.95
R7117:Col28a1	UTSW	6	8013122	missense	possibly damaging	0.89
R7375:Col28a1	UTSW	6	7998499	missense	possibly damaging	0.46
R8236:Col28a1	UTSW	6	8097024	critical splice donor site	probably null
R8272:Col28a1	UTSW	6	8154175	missense	possibly damaging	0.92
R8559:Col28a1	UTSW	6	8166681	missense	unknown
R8712:Col28a1	UTSW	6	8013133	missense	probably benign	0.32
R8782:Col28a1	UTSW	6	8175227	missense	unknown
R8838:Col28a1	UTSW	6	8091839	critical splice donor site	probably null
R8885:Col28a1	UTSW	6	8127360	splice site	probably benign
R9132:Col28a1	UTSW	6	8014993	missense	probably damaging	1.00
R9153:Col28a1	UTSW	6	8022765	missense	probably benign	0.03
R9159:Col28a1	UTSW	6	8014993	missense	probably damaging	1.00
R9310:Col28a1	UTSW	6	8175414	missense	unknown
R9327:Col28a1	UTSW	6	8175653	missense	unknown
R9423:Col28a1	UTSW	6	7999601	missense	probably benign	0.34
Z1177:Col28a1	UTSW	6	8062283	missense	possibly damaging	0.52
Z1177:Col28a1	UTSW	6	8127352	missense	probably damaging	1.00
Z1177:Col28a1	UTSW	6	8175630	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TAAATGTCCGGAGATCCTTCCAAG -3'
(R):5'- CCTGTTCTATTCCTATGATGAATGCAG -3'

Sequencing Primer
(F):5'- GTCCGGAGATCCTTCCAAGAAGAC -3'
(R):5'- TGCAGACACATTTTCTCATTTGG -3'

Posted On

2015-07-07