Incidental Mutation 'R4417:Lrrc32'
ID326882
Institutional Source Beutler Lab
Gene Symbol Lrrc32
Ensembl Gene ENSMUSG00000090958
Gene Nameleucine rich repeat containing 32
SynonymsD7H11S833E, EG434215, Garp, D11S833Eh
MMRRC Submission 041138-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R4417 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location98489283-98502181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 98498937 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 308 (R308L)
Ref Sequence ENSEMBL: ENSMUSP00000145859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165205] [ENSMUST00000205937] [ENSMUST00000205956]
Predicted Effect probably benign
Transcript: ENSMUST00000165205
AA Change: R308L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000133205
Gene: ENSMUSG00000090958
AA Change: R308L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:LRRNT 22 54 3e-12 BLAST
LRR_TYP 73 96 9.44e-2 SMART
LRR 97 123 1.86e2 SMART
LRR 124 148 3.01e2 SMART
LRR 149 172 5.41e0 SMART
LRR 173 196 1.51e0 SMART
LRR_TYP 197 220 7.67e-2 SMART
LRR 265 287 1.49e2 SMART
LRR 315 338 4.97e0 SMART
LRR 339 362 8.01e0 SMART
LRR 363 384 5.57e1 SMART
LRR_TYP 386 409 3.44e-4 SMART
low complexity region 425 437 N/A INTRINSIC
LRR 443 466 2.33e2 SMART
LRR 514 536 2.03e1 SMART
LRR 537 559 2.61e1 SMART
Blast:LRR 561 588 6e-11 BLAST
transmembrane domain 630 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205937
Predicted Effect probably benign
Transcript: ENSMUST00000205956
AA Change: R308L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I membrane protein which contains 20 leucine-rich repeats. Alterations in the chromosomal region 11q13-11q14 are involved in several pathologies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in T cells exhibit reduced regulatory T cell ability to drive Th17 differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
BC004004 G A 17: 29,282,275 probably benign Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E61G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Crhbp T C 13: 95,443,877 S65G probably benign Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glp2r T C 11: 67,664,516 probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Kcnj2 T C 11: 111,072,189 S136P probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lcp2 G T 11: 34,050,917 E33D probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mfsd12 A G 10: 81,364,703 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Odf2 T A 2: 29,915,321 probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Prdm13 T C 4: 21,678,756 E578G probably benign Het
Pum3 A G 19: 27,422,716 I183T probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Stradb T C 1: 58,994,372 V398A probably benign Het
Tlr4 A T 4: 66,839,303 N111I probably damaging Het
Tnip2 G A 5: 34,503,581 R176* probably null Het
Tomm7 A G 5: 23,843,979 I32T probably benign Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zfp341 T C 2: 154,628,987 L308P possibly damaging Het
Zmym6 T C 4: 127,092,988 S154P probably damaging Het
Other mutations in Lrrc32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Lrrc32 APN 7 98498376 missense probably damaging 1.00
IGL01484:Lrrc32 APN 7 98494235 missense probably damaging 0.99
IGL01608:Lrrc32 APN 7 98499357 missense probably benign 0.01
IGL02025:Lrrc32 APN 7 98499560 missense probably benign 0.00
IGL02026:Lrrc32 APN 7 98499560 missense probably benign 0.00
IGL03061:Lrrc32 APN 7 98499422 missense probably benign 0.04
IGL03191:Lrrc32 APN 7 98498247 missense possibly damaging 0.66
R0706:Lrrc32 UTSW 7 98499710 missense probably damaging 1.00
R0947:Lrrc32 UTSW 7 98498883 missense probably benign
R1470:Lrrc32 UTSW 7 98499357 missense probably benign
R1470:Lrrc32 UTSW 7 98499357 missense probably benign
R2879:Lrrc32 UTSW 7 98499777 missense probably benign 0.02
R3608:Lrrc32 UTSW 7 98499186 missense probably benign 0.09
R4798:Lrrc32 UTSW 7 98499017 missense probably damaging 1.00
R4872:Lrrc32 UTSW 7 98498520 missense probably damaging 0.99
R5813:Lrrc32 UTSW 7 98498411 missense probably damaging 1.00
R6062:Lrrc32 UTSW 7 98498541 missense probably benign 0.00
R6742:Lrrc32 UTSW 7 98498832 missense probably benign 0.00
R6930:Lrrc32 UTSW 7 98499264 missense possibly damaging 0.89
R7265:Lrrc32 UTSW 7 98499437 missense probably damaging 1.00
R7367:Lrrc32 UTSW 7 98498879 nonsense probably null
R7372:Lrrc32 UTSW 7 98499807 missense probably benign 0.28
R7414:Lrrc32 UTSW 7 98499994 missense probably benign 0.01
R7485:Lrrc32 UTSW 7 98498207 missense possibly damaging 0.94
R7679:Lrrc32 UTSW 7 98499687 missense possibly damaging 0.91
R7713:Lrrc32 UTSW 7 98499338 missense probably damaging 0.99
R8782:Lrrc32 UTSW 7 98499063 missense probably damaging 1.00
R8815:Lrrc32 UTSW 7 98499035 missense probably damaging 1.00
Z1088:Lrrc32 UTSW 7 98499060 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCATTGAGGCCTTCCAGAC -3'
(R):5'- TTGTGGCTCAAGTCCAAAAGC -3'

Sequencing Primer
(F):5'- ACAGGCCCAGTTCCAGTTG -3'
(R):5'- GGCTCAAGTCCAAAAGCACCAG -3'
Posted On2015-07-07