Incidental Mutation 'R4417:Stox1'
ID326888
Institutional Source Beutler Lab
Gene Symbol Stox1
Ensembl Gene ENSMUSG00000036923
Gene Namestorkhead box 1
Synonyms4732470K04Rik
MMRRC Submission 041138-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R4417 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62659043-62726128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62659569 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 975 (N975S)
Ref Sequence ENSEMBL: ENSMUSP00000114652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133371] [ENSMUST00000148720]
Predicted Effect probably benign
Transcript: ENSMUST00000133371
AA Change: N975S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114652
Gene: ENSMUSG00000036923
AA Change: N975S

DomainStartEndE-ValueType
low complexity region 31 71 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Pfam:Stork_head 108 186 4.4e-37 PFAM
low complexity region 416 429 N/A INTRINSIC
low complexity region 448 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148720
SMART Domains Protein: ENSMUSP00000116180
Gene: ENSMUSG00000036923

DomainStartEndE-ValueType
Pfam:Stork_head 19 98 9e-40 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may function as a DNA binding protein. Mutations in this gene are associated with pre-eclampsia/eclampsia 4 (PEE4). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
BC004004 G A 17: 29,282,275 probably benign Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E61G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Crhbp T C 13: 95,443,877 S65G probably benign Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glp2r T C 11: 67,664,516 probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Kcnj2 T C 11: 111,072,189 S136P probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lcp2 G T 11: 34,050,917 E33D probably benign Het
Lrrc32 G T 7: 98,498,937 R308L probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mfsd12 A G 10: 81,364,703 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Odf2 T A 2: 29,915,321 probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Prdm13 T C 4: 21,678,756 E578G probably benign Het
Pum3 A G 19: 27,422,716 I183T probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stradb T C 1: 58,994,372 V398A probably benign Het
Tlr4 A T 4: 66,839,303 N111I probably damaging Het
Tnip2 G A 5: 34,503,581 R176* probably null Het
Tomm7 A G 5: 23,843,979 I32T probably benign Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zfp341 T C 2: 154,628,987 L308P possibly damaging Het
Zmym6 T C 4: 127,092,988 S154P probably damaging Het
Other mutations in Stox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Stox1 APN 10 62667913 missense probably damaging 1.00
IGL01462:Stox1 APN 10 62664682 missense probably benign 0.14
IGL01558:Stox1 APN 10 62667872 missense probably damaging 0.98
IGL02391:Stox1 APN 10 62659676 splice site probably benign
IGL02454:Stox1 APN 10 62667826 missense probably damaging 1.00
IGL02510:Stox1 APN 10 62664047 missense probably benign 0.14
IGL02635:Stox1 APN 10 62664906 missense probably benign 0.02
R1036:Stox1 UTSW 10 62667895 missense probably damaging 1.00
R1486:Stox1 UTSW 10 62664636 missense probably benign 0.06
R1751:Stox1 UTSW 10 62659666 missense probably damaging 0.97
R1763:Stox1 UTSW 10 62667965 missense probably damaging 1.00
R1892:Stox1 UTSW 10 62665399 missense possibly damaging 0.56
R2128:Stox1 UTSW 10 62664535 missense probably benign 0.42
R2406:Stox1 UTSW 10 62664166 missense probably benign 0.01
R4078:Stox1 UTSW 10 62666031 missense probably benign 0.00
R4414:Stox1 UTSW 10 62659569 missense probably benign 0.00
R4415:Stox1 UTSW 10 62659569 missense probably benign 0.00
R4416:Stox1 UTSW 10 62659569 missense probably benign 0.00
R4799:Stox1 UTSW 10 62665737 missense probably damaging 1.00
R5261:Stox1 UTSW 10 62667841 missense probably damaging 0.98
R5323:Stox1 UTSW 10 62664033 missense possibly damaging 0.71
R5885:Stox1 UTSW 10 62664848 missense probably damaging 0.99
R6182:Stox1 UTSW 10 62664942 missense probably damaging 0.99
R7548:Stox1 UTSW 10 62666167 missense probably damaging 0.99
R7757:Stox1 UTSW 10 62663964 missense probably damaging 1.00
R7765:Stox1 UTSW 10 62665999 missense probably benign 0.26
R7846:Stox1 UTSW 10 62659526 missense probably damaging 1.00
R7867:Stox1 UTSW 10 62664944 missense probably benign 0.00
R8077:Stox1 UTSW 10 62665566 missense probably damaging 1.00
R8409:Stox1 UTSW 10 62666016 missense probably benign 0.00
R8413:Stox1 UTSW 10 62664975 missense probably damaging 1.00
R8443:Stox1 UTSW 10 62665764 missense probably damaging 1.00
R8822:Stox1 UTSW 10 62664121 missense probably damaging 1.00
RF014:Stox1 UTSW 10 62664246 missense probably benign 0.06
Z1176:Stox1 UTSW 10 62664018 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAGCTTCCAAGGACTTTCAC -3'
(R):5'- TCCTAATGGTACTGGGAGGC -3'

Sequencing Primer
(F):5'- CCAGTTTCTACAAGAGTTCTCCAAAG -3'
(R):5'- ACATGAGAATGTGTTTCTGAAGG -3'
Posted On2015-07-07