Incidental Mutation 'R4417:Mfsd12'
ID326889
Institutional Source Beutler Lab
Gene Symbol Mfsd12
Ensembl Gene ENSMUSG00000034854
Gene Namemajor facilitator superfamily domain containing 12
SynonymsWdt1, F630110N24Rik
MMRRC Submission 041138-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.562) question?
Stock #R4417 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location81357491-81366225 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 81364703 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020456] [ENSMUST00000020457] [ENSMUST00000044844] [ENSMUST00000118812] [ENSMUST00000132368] [ENSMUST00000140901]
Predicted Effect probably benign
Transcript: ENSMUST00000020456
SMART Domains Protein: ENSMUSP00000020456
Gene: ENSMUSG00000020234

DomainStartEndE-ValueType
Pfam:DUF4531 23 204 1.3e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020457
SMART Domains Protein: ENSMUSP00000020457
Gene: ENSMUSG00000020235

DomainStartEndE-ValueType
Blast:WD40 172 213 8e-21 BLAST
WD40 218 257 1.2e-2 SMART
WD40 260 297 6.79e-2 SMART
WD40 302 341 3.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044844
SMART Domains Protein: ENSMUSP00000036116
Gene: ENSMUSG00000034854

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:MFS_2 20 423 5.2e-43 PFAM
Pfam:MFS_1 154 416 6.8e-12 PFAM
transmembrane domain 441 463 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118812
SMART Domains Protein: ENSMUSP00000112868
Gene: ENSMUSG00000020235

DomainStartEndE-ValueType
WD40 129 168 5.6e-3 SMART
WD40 171 208 6.79e-2 SMART
WD40 213 252 3.99e-8 SMART
WD40 255 297 2.84e-4 SMART
WD40 300 340 1.98e1 SMART
WD40 343 382 1.11e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130762
Predicted Effect probably benign
Transcript: ENSMUST00000131736
SMART Domains Protein: ENSMUSP00000123068
Gene: ENSMUSG00000020234

DomainStartEndE-ValueType
Pfam:DUF4531 1 128 2.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132368
SMART Domains Protein: ENSMUSP00000120259
Gene: ENSMUSG00000034854

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:MFS_2 20 102 3.7e-11 PFAM
low complexity region 118 124 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138343
Predicted Effect probably benign
Transcript: ENSMUST00000140901
SMART Domains Protein: ENSMUSP00000114203
Gene: ENSMUSG00000020235

DomainStartEndE-ValueType
Blast:WD40 172 213 1e-19 BLAST
WD40 218 257 1.2e-2 SMART
WD40 260 297 6.79e-2 SMART
WD40 302 341 3.99e-8 SMART
WD40 344 386 2.84e-4 SMART
WD40 389 429 1.98e1 SMART
WD40 432 471 1.11e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150824
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit a grey (grizzled) coat. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
BC004004 G A 17: 29,282,275 probably benign Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E61G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Crhbp T C 13: 95,443,877 S65G probably benign Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glp2r T C 11: 67,664,516 probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Kcnj2 T C 11: 111,072,189 S136P probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lcp2 G T 11: 34,050,917 E33D probably benign Het
Lrrc32 G T 7: 98,498,937 R308L probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Odf2 T A 2: 29,915,321 probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Prdm13 T C 4: 21,678,756 E578G probably benign Het
Pum3 A G 19: 27,422,716 I183T probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Stradb T C 1: 58,994,372 V398A probably benign Het
Tlr4 A T 4: 66,839,303 N111I probably damaging Het
Tnip2 G A 5: 34,503,581 R176* probably null Het
Tomm7 A G 5: 23,843,979 I32T probably benign Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zfp341 T C 2: 154,628,987 L308P possibly damaging Het
Zmym6 T C 4: 127,092,988 S154P probably damaging Het
Other mutations in Mfsd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01556:Mfsd12 APN 10 81363024 missense probably damaging 0.98
IGL01928:Mfsd12 APN 10 81365788 unclassified probably benign
P0038:Mfsd12 UTSW 10 81362218 missense probably benign 0.02
R0048:Mfsd12 UTSW 10 81362814 missense possibly damaging 0.77
R0048:Mfsd12 UTSW 10 81362814 missense possibly damaging 0.77
R0152:Mfsd12 UTSW 10 81357799 missense probably damaging 1.00
R0317:Mfsd12 UTSW 10 81357799 missense probably damaging 1.00
R0565:Mfsd12 UTSW 10 81361409 missense probably benign 0.00
R1283:Mfsd12 UTSW 10 81361435 missense probably benign 0.00
R1927:Mfsd12 UTSW 10 81362087 missense probably benign 0.15
R1983:Mfsd12 UTSW 10 81362256 unclassified probably null
R1994:Mfsd12 UTSW 10 81357681 missense probably damaging 1.00
R1995:Mfsd12 UTSW 10 81357681 missense probably damaging 1.00
R2055:Mfsd12 UTSW 10 81360229 missense probably damaging 1.00
R2197:Mfsd12 UTSW 10 81357734 missense probably damaging 1.00
R3120:Mfsd12 UTSW 10 81361215 missense probably benign 0.00
R4162:Mfsd12 UTSW 10 81361097 critical splice acceptor site probably null
R4163:Mfsd12 UTSW 10 81361097 critical splice acceptor site probably null
R5622:Mfsd12 UTSW 10 81363627 missense probably null 0.98
R6407:Mfsd12 UTSW 10 81362233 unclassified probably null
R7759:Mfsd12 UTSW 10 81363593 missense probably benign 0.10
R7780:Mfsd12 UTSW 10 81357884 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AGTGACCCACGTGCAGTACTAC -3'
(R):5'- AAATTCACGCCCATGGGAC -3'

Sequencing Primer
(F):5'- ACGTGCAGTACTACCCCCG -3'
(R):5'- GGCCAGGTGTGGTTCAC -3'
Posted On2015-07-07