Incidental Mutation 'R4417:Clhc1'
ID326890
Institutional Source Beutler Lab
Gene Symbol Clhc1
Ensembl Gene ENSMUSG00000020461
Gene Nameclathrin heavy chain linker domain containing 1
Synonyms1700034F02Rik
MMRRC Submission 041138-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4417 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location29547950-29578367 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29571826 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 453 (I453T)
Ref Sequence ENSEMBL: ENSMUSP00000147007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020753] [ENSMUST00000208530]
Predicted Effect probably benign
Transcript: ENSMUST00000020753
AA Change: I464T

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020753
Gene: ENSMUSG00000020461
AA Change: I464T

DomainStartEndE-ValueType
Pfam:TSNAXIP1_N 28 152 2.6e-26 PFAM
Pfam:Clathrin_H_link 302 365 3.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131366
Predicted Effect possibly damaging
Transcript: ENSMUST00000208530
AA Change: I453T

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1011 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
BC004004 G A 17: 29,282,275 probably benign Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E61G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Crhbp T C 13: 95,443,877 S65G probably benign Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glp2r T C 11: 67,664,516 probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Kcnj2 T C 11: 111,072,189 S136P probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lcp2 G T 11: 34,050,917 E33D probably benign Het
Lrrc32 G T 7: 98,498,937 R308L probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mfsd12 A G 10: 81,364,703 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Odf2 T A 2: 29,915,321 probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Prdm13 T C 4: 21,678,756 E578G probably benign Het
Pum3 A G 19: 27,422,716 I183T probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Stradb T C 1: 58,994,372 V398A probably benign Het
Tlr4 A T 4: 66,839,303 N111I probably damaging Het
Tnip2 G A 5: 34,503,581 R176* probably null Het
Tomm7 A G 5: 23,843,979 I32T probably benign Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zfp341 T C 2: 154,628,987 L308P possibly damaging Het
Zmym6 T C 4: 127,092,988 S154P probably damaging Het
Other mutations in Clhc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Clhc1 APN 11 29571745 missense probably damaging 0.99
IGL00976:Clhc1 APN 11 29561389 missense probably benign 0.43
IGL01826:Clhc1 APN 11 29553765 splice site probably null
IGL02029:Clhc1 APN 11 29560798 missense probably benign 0.01
IGL02479:Clhc1 APN 11 29578107 missense probably damaging 0.98
R0553:Clhc1 UTSW 11 29561366 splice site probably benign
R1313:Clhc1 UTSW 11 29571678 missense probably benign
R1313:Clhc1 UTSW 11 29571678 missense probably benign
R1482:Clhc1 UTSW 11 29553725 missense probably damaging 1.00
R1624:Clhc1 UTSW 11 29569287 missense possibly damaging 0.85
R1742:Clhc1 UTSW 11 29557647 splice site probably null
R2094:Clhc1 UTSW 11 29557771 missense probably benign 0.13
R2130:Clhc1 UTSW 11 29557663 missense probably benign 0.33
R2237:Clhc1 UTSW 11 29569329 missense probably benign 0.30
R3814:Clhc1 UTSW 11 29571826 missense possibly damaging 0.57
R3854:Clhc1 UTSW 11 29571789 missense probably damaging 1.00
R4659:Clhc1 UTSW 11 29578229 makesense probably null
R5021:Clhc1 UTSW 11 29560627 missense probably benign 0.01
R5246:Clhc1 UTSW 11 29575434 missense probably damaging 1.00
R5287:Clhc1 UTSW 11 29578244 utr 3 prime probably benign
R5657:Clhc1 UTSW 11 29561431 missense probably benign 0.03
R5771:Clhc1 UTSW 11 29563854 missense possibly damaging 0.94
R6050:Clhc1 UTSW 11 29561397 missense possibly damaging 0.76
R6211:Clhc1 UTSW 11 29578145 missense probably damaging 1.00
R6500:Clhc1 UTSW 11 29560542 missense possibly damaging 0.87
R6615:Clhc1 UTSW 11 29578149 missense possibly damaging 0.75
R6944:Clhc1 UTSW 11 29569346 missense probably damaging 0.97
R7252:Clhc1 UTSW 11 29563937 missense probably benign 0.01
R7860:Clhc1 UTSW 11 29557651 critical splice acceptor site probably null
R8221:Clhc1 UTSW 11 29553751 missense possibly damaging 0.95
R8259:Clhc1 UTSW 11 29553746 missense probably benign 0.37
R8769:Clhc1 UTSW 11 29561401 missense probably damaging 0.99
X0023:Clhc1 UTSW 11 29569305 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATTTTCTGAGAAGGCTGGCG -3'
(R):5'- TGCTACATGATTCTAGCAATAGCCAC -3'

Sequencing Primer
(F):5'- AGAAGGCTGGCGATATTATATTTGC -3'
(R):5'- GTTTCAAACAATGCCAGCT -3'
Posted On2015-07-07