Incidental Mutation 'R4417:Lcp2'
ID326891
Institutional Source Beutler Lab
Gene Symbol Lcp2
Ensembl Gene ENSMUSG00000002699
Gene Namelymphocyte cytosolic protein 2
Synonymstwm, SLP76, SLP-76
MMRRC Submission 041138-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4417 (G1)
Quality Score178
Status Not validated
Chromosome11
Chromosomal Location34046920-34092295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34050917 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 33 (E33D)
Ref Sequence ENSEMBL: ENSMUSP00000056621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052413] [ENSMUST00000109329]
Predicted Effect probably benign
Transcript: ENSMUST00000052413
AA Change: E33D

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000056621
Gene: ENSMUSG00000002699
AA Change: E33D

DomainStartEndE-ValueType
SAM 12 78 9.3e-4 SMART
low complexity region 109 127 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
internal_repeat_1 274 321 1.93e-5 PROSPERO
low complexity region 328 339 N/A INTRINSIC
low complexity region 400 412 N/A INTRINSIC
SH2 421 512 4.44e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109329
AA Change: E33D

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104952
Gene: ENSMUSG00000002699
AA Change: E33D

DomainStartEndE-ValueType
SAM 12 78 9.3e-4 SMART
low complexity region 109 127 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
internal_repeat_1 274 321 1.86e-5 PROSPERO
low complexity region 328 339 N/A INTRINSIC
low complexity region 400 412 N/A INTRINSIC
SH2 421 508 8.9e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141450
Predicted Effect probably benign
Transcript: ENSMUST00000169878
AA Change: E33D

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126796
Gene: ENSMUSG00000002699
AA Change: E33D

DomainStartEndE-ValueType
SAM 12 78 9.3e-4 SMART
low complexity region 109 127 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
internal_repeat_1 274 321 1.87e-5 PROSPERO
low complexity region 328 339 N/A INTRINSIC
low complexity region 399 411 N/A INTRINSIC
SH2 420 511 4.44e-25 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that acts as a substrate of the T cell antigen receptor (TCR)-activated protein tyrosine kinase pathway. The encoded protein associates with growth factor receptor bound protein 2, and is thought to play a role TCR-mediated intracellular signal transduction. A similar protein in mouse plays a role in normal T-cell development and activation. Mice lacking this gene show subcutaneous and intraperitoneal fetal hemorrhaging, dysfunctional platelets and impaired viability. [provided by RefSeq, Nov 2016]
PHENOTYPE: T cell development is blocked and T cell receptor signaling impaired in homozygous point mutants. Double positive thymocyte and single positive T cell numbers are much reduced. Both positive and negative thymocyte selection is abnormal. Mice have high IgG and IgE levels and exhibit autoimmunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
BC004004 G A 17: 29,282,275 probably benign Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E61G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Crhbp T C 13: 95,443,877 S65G probably benign Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glp2r T C 11: 67,664,516 probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Kcnj2 T C 11: 111,072,189 S136P probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lrrc32 G T 7: 98,498,937 R308L probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mfsd12 A G 10: 81,364,703 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Odf2 T A 2: 29,915,321 probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Prdm13 T C 4: 21,678,756 E578G probably benign Het
Pum3 A G 19: 27,422,716 I183T probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Stradb T C 1: 58,994,372 V398A probably benign Het
Tlr4 A T 4: 66,839,303 N111I probably damaging Het
Tnip2 G A 5: 34,503,581 R176* probably null Het
Tomm7 A G 5: 23,843,979 I32T probably benign Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zfp341 T C 2: 154,628,987 L308P possibly damaging Het
Zmym6 T C 4: 127,092,988 S154P probably damaging Het
Other mutations in Lcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Lcp2 APN 11 34047345 start gained probably benign
IGL01730:Lcp2 APN 11 34050943 missense possibly damaging 0.91
IGL02174:Lcp2 APN 11 34050966 splice site probably benign
IGL02228:Lcp2 APN 11 34047424 missense probably damaging 1.00
IGL02814:Lcp2 APN 11 34071033 missense probably damaging 1.00
R0142:Lcp2 UTSW 11 34082418 missense probably damaging 0.97
R0277:Lcp2 UTSW 11 34054322 missense probably damaging 1.00
R0281:Lcp2 UTSW 11 34069854 splice site probably benign
R0323:Lcp2 UTSW 11 34054322 missense probably damaging 1.00
R0437:Lcp2 UTSW 11 34087229 missense probably benign 0.00
R0632:Lcp2 UTSW 11 34082426 missense possibly damaging 0.87
R1479:Lcp2 UTSW 11 34075068 missense probably benign 0.01
R1570:Lcp2 UTSW 11 34089601 missense probably benign 0.07
R1744:Lcp2 UTSW 11 34069911 splice site probably null
R2212:Lcp2 UTSW 11 34070995 missense probably benign 0.14
R2910:Lcp2 UTSW 11 34068970 unclassified probably null
R2911:Lcp2 UTSW 11 34068970 unclassified probably null
R3196:Lcp2 UTSW 11 34090670 missense probably benign 0.05
R4012:Lcp2 UTSW 11 34068439 missense probably damaging 1.00
R4411:Lcp2 UTSW 11 34087173 unclassified probably benign
R4423:Lcp2 UTSW 11 34078226 intron probably benign
R4718:Lcp2 UTSW 11 34070992 missense probably benign 0.09
R5090:Lcp2 UTSW 11 34089725 nonsense probably null
R6347:Lcp2 UTSW 11 34082501 missense probably benign 0.10
R7315:Lcp2 UTSW 11 34069906 critical splice donor site probably null
R7694:Lcp2 UTSW 11 34050924 missense probably benign 0.16
R7910:Lcp2 UTSW 11 34088061 missense probably damaging 1.00
R7991:Lcp2 UTSW 11 34088061 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACTAGAGTGCACAGTTTC -3'
(R):5'- AAAAGGCTTTGTGGAGGCATTG -3'

Sequencing Primer
(F):5'- GAGTGCACAGTTTCTCTATTTCAG -3'
(R):5'- GGCATTGACCACAGACATTG -3'
Posted On2015-07-07