Mutagenetix > Incidental Mutations

Incidental Mutation 'R4417:Dnah9'

326892

Institutional Source

Beutler Lab

Gene Symbol

Dnah9

Ensembl Gene

ENSMUSG00000056752

Gene Name

dynein, axonemal, heavy chain 9

Synonyms

D11Ertd686e, Dnahc9

MMRRC Submission

041138-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.392) question?

Stock #

R4417 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65831282-66168551 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 65981214 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 2730 (Q2730L)

Ref Sequence

ENSEMBL: ENSMUSP00000079494 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080665]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000080665
AA Change: Q2730L

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: Q2730L

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	209	787	3.6e-164	PFAM
coiled coil region	788	820	N/A	INTRINSIC
low complexity region	1228	1240	N/A	INTRINSIC
Pfam:DHC_N2	1290	1699	1.4e-134	PFAM
AAA	1863	1999	4.9e-1	SMART
AAA	2141	2341	1.99e0	SMART
AAA	2468	2614	6.75e-1	SMART
Pfam:AAA_8	2786	3053	1.1e-165	PFAM
Pfam:MT	3065	3408	7.2e-208	PFAM
Pfam:AAA_9	3430	3652	3.2e-87	PFAM
Pfam:Dynein_heavy	3786	4482	1e-241	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000152386
AA Change: Q279L

SMART Domains

Protein: ENSMUSP00000116499
Gene: ENSMUSG00000056752
AA Change: Q279L

Domain	Start	End	E-Value	Type
Pfam:AAA_7	1	258	3e-155	PFAM
Pfam:AAA_8	336	603	3.9e-166	PFAM
Pfam:MT	615	958	2.3e-208	PFAM
Pfam:AAA_9	980	1202	1.1e-87	PFAM
Pfam:Dynein_heavy	1336	1514	2.4e-52	PFAM
Pfam:Dynein_heavy	1508	1956	8.6e-155	PFAM

Meta Mutation Damage Score

0.1226

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
A630001G21Rik	T	A	1: 85,726,463	Y51F	probably damaging	Het
Abi3bp	C	A	16: 56,654,035	T631K	probably damaging	Het
BC004004	G	A	17: 29,282,275		probably benign	Het
Cabp1	G	A	5: 115,186,037	S7L	possibly damaging	Het
Cdc23	ACC	AC	18: 34,637,318		probably null	Het
Clhc1	T	C	11: 29,571,826	I453T	possibly damaging	Het
Col28a1	T	A	6: 8,175,666	I61F	possibly damaging	Het
Col2a1	T	C	15: 97,998,585	E61G	unknown	Het
Col6a4	C	T	9: 106,072,016	V807I	probably damaging	Het
Crhbp	T	C	13: 95,443,877	S65G	probably benign	Het
Epx	T	A	11: 87,869,430	R453*	probably null	Het
Fez1	T	C	9: 36,870,472		probably benign	Het
G530012D18Rik	G	C	1: 85,577,202		probably benign	Het
Glp2r	T	C	11: 67,664,516		probably benign	Het
Gm1141	G	A	X: 71,939,619	C399Y	possibly damaging	Het
Gpm6a	T	A	8: 55,050,188	N157K	probably damaging	Het
Kcnj2	T	C	11: 111,072,189	S136P	probably damaging	Het
Lad1	A	G	1: 135,828,746	D364G	probably benign	Het
Lcp2	G	T	11: 34,050,917	E33D	probably benign	Het
Lrrc32	G	T	7: 98,498,937	R308L	probably benign	Het
Matr3	C	A	18: 35,572,118	A32D	probably damaging	Het
Mfsd12	A	G	10: 81,364,703		probably benign	Het
Mtmr11	T	C	3: 96,167,891		probably benign	Het
Notch2	A	G	3: 98,131,270	D1243G	possibly damaging	Het
Odf2	T	A	2: 29,915,321		probably benign	Het
Oit3	T	C	10: 59,428,103	Y403C	probably damaging	Het
Olfr1233	T	C	2: 89,339,987	E105G	probably benign	Het
Pitpnm2	G	T	5: 124,123,569	R977S	probably damaging	Het
Prdm13	T	C	4: 21,678,756	E578G	probably benign	Het
Pum3	A	G	19: 27,422,716	I183T	probably damaging	Het
Rdh14	G	A	12: 10,391,231		probably null	Het
Slc35b2	G	A	17: 45,566,429	V161M	probably benign	Het
Slit1	A	G	19: 41,614,469	C968R	probably damaging	Het
Spag9	A	T	11: 94,060,346		probably benign	Het
Stox1	T	C	10: 62,659,569	N975S	probably benign	Het
Stradb	T	C	1: 58,994,372	V398A	probably benign	Het
Tlr4	A	T	4: 66,839,303	N111I	probably damaging	Het
Tnip2	G	A	5: 34,503,581	R176*	probably null	Het
Tomm7	A	G	5: 23,843,979	I32T	probably benign	Het
Trank1	T	C	9: 111,365,968	I1020T	probably benign	Het
Ugt1a10	T	G	1: 88,055,995	S172A	probably benign	Het
Vmn2r115	T	A	17: 23,345,880	M247K	probably benign	Het
Zfp341	T	C	2: 154,628,987	L308P	possibly damaging	Het
Zmym6	T	C	4: 127,092,988	S154P	probably damaging	Het

Other mutations in Dnah9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00696:Dnah9	APN	11	65841238	splice site	probably benign
IGL00805:Dnah9	APN	11	65881695	missense	probably benign	0.00
IGL00826:Dnah9	APN	11	65989942	missense	probably damaging	1.00
IGL01108:Dnah9	APN	11	65849980	missense	possibly damaging	0.93
IGL01152:Dnah9	APN	11	66072056	missense	probably damaging	1.00
IGL01353:Dnah9	APN	11	66080571	missense	probably damaging	1.00
IGL01364:Dnah9	APN	11	66155459	missense	probably damaging	1.00
IGL01479:Dnah9	APN	11	65955717	missense	probably benign	0.14
IGL01537:Dnah9	APN	11	65947680	missense	probably benign
IGL01565:Dnah9	APN	11	66033829	missense	possibly damaging	0.95
IGL01597:Dnah9	APN	11	66118830	missense	probably damaging	1.00
IGL01619:Dnah9	APN	11	65831615	nonsense	probably null
IGL01625:Dnah9	APN	11	66044645	missense	probably damaging	1.00
IGL01803:Dnah9	APN	11	66118829	missense	probably damaging	1.00
IGL01819:Dnah9	APN	11	66108126	missense	probably benign	0.33
IGL01896:Dnah9	APN	11	66130666	missense	possibly damaging	0.89
IGL01922:Dnah9	APN	11	66075034	splice site	probably benign
IGL01923:Dnah9	APN	11	66125235	splice site	probably benign
IGL02059:Dnah9	APN	11	66072958	missense	probably damaging	1.00
IGL02068:Dnah9	APN	11	66061045	missense	probably damaging	1.00
IGL02135:Dnah9	APN	11	66117492	missense	possibly damaging	0.63
IGL02146:Dnah9	APN	11	65927700	missense	probably damaging	1.00
IGL02264:Dnah9	APN	11	66080488	splice site	probably benign
IGL02325:Dnah9	APN	11	65834217	missense	probably damaging	1.00
IGL02426:Dnah9	APN	11	66125153	missense	probably benign
IGL02440:Dnah9	APN	11	65955246	missense	probably damaging	1.00
IGL02471:Dnah9	APN	11	65947618	nonsense	probably null
IGL02496:Dnah9	APN	11	66029363	missense	probably damaging	1.00
IGL02672:Dnah9	APN	11	65927601	missense	probably benign	0.02
IGL02718:Dnah9	APN	11	65886640	missense	probably damaging	0.99
IGL02832:Dnah9	APN	11	66040346	missense	probably damaging	1.00
IGL02851:Dnah9	APN	11	66037744	splice site	probably benign
IGL02859:Dnah9	APN	11	65881619	splice site	probably benign
IGL02864:Dnah9	APN	11	66061003	missense	probably damaging	1.00
IGL02954:Dnah9	APN	11	66118967	missense	probably damaging	1.00
IGL02987:Dnah9	APN	11	65855272	missense	probably damaging	0.98
IGL02987:Dnah9	APN	11	65841273	missense	probably benign	0.23
IGL03160:Dnah9	APN	11	66108054	missense	probably damaging	0.98
IGL03171:Dnah9	APN	11	65981241	missense	probably benign	0.13
IGL03180:Dnah9	APN	11	65886639	missense	probably damaging	0.99
IGL03388:Dnah9	APN	11	65947542	missense	probably damaging	1.00
anarchy	UTSW	11	65955248	missense	probably damaging	0.99
sacco	UTSW	11	66168079	missense	possibly damaging	0.82
vanzetti	UTSW	11	65855372	nonsense	probably null
IGL02837:Dnah9	UTSW	11	65874196	missense	probably damaging	1.00
PIT4280001:Dnah9	UTSW	11	66005013	missense	probably benign	0.44
R0021:Dnah9	UTSW	11	65969979	missense	probably benign	0.36
R0021:Dnah9	UTSW	11	65969979	missense	probably benign	0.36
R0025:Dnah9	UTSW	11	65969955	splice site	probably benign
R0025:Dnah9	UTSW	11	65969955	splice site	probably benign
R0070:Dnah9	UTSW	11	66160040	missense	probably benign	0.10
R0164:Dnah9	UTSW	11	65918804	nonsense	probably null
R0164:Dnah9	UTSW	11	65918804	nonsense	probably null
R0180:Dnah9	UTSW	11	66147290	missense	probably damaging	1.00
R0195:Dnah9	UTSW	11	65895905	missense	probably benign	0.30
R0230:Dnah9	UTSW	11	65855315	missense	probably damaging	1.00
R0243:Dnah9	UTSW	11	65911852	missense	possibly damaging	0.91
R0279:Dnah9	UTSW	11	65911789	critical splice donor site	probably null
R0288:Dnah9	UTSW	11	66025134	critical splice donor site	probably null
R0309:Dnah9	UTSW	11	66026972	splice site	probably benign
R0356:Dnah9	UTSW	11	66130562	critical splice donor site	probably null
R0403:Dnah9	UTSW	11	66084789	missense	possibly damaging	0.90
R0413:Dnah9	UTSW	11	66108135	missense	probably damaging	1.00
R0448:Dnah9	UTSW	11	65918713	splice site	probably benign
R0496:Dnah9	UTSW	11	66075135	missense	probably null	1.00
R0557:Dnah9	UTSW	11	66084666	missense	probably damaging	1.00
R0584:Dnah9	UTSW	11	65990489	missense	probably damaging	1.00
R0598:Dnah9	UTSW	11	66118877	missense	probably benign	0.02
R0599:Dnah9	UTSW	11	65965689	missense	probably damaging	1.00
R0606:Dnah9	UTSW	11	65841333	missense	probably damaging	1.00
R0666:Dnah9	UTSW	11	66085458	missense	probably benign	0.01
R0715:Dnah9	UTSW	11	66081248	splice site	probably benign
R0726:Dnah9	UTSW	11	65965681	missense	probably damaging	1.00
R0737:Dnah9	UTSW	11	66107898	missense	probably damaging	1.00
R0763:Dnah9	UTSW	11	66155530	missense	probably benign	0.30
R0792:Dnah9	UTSW	11	65896001	missense	possibly damaging	0.84
R0829:Dnah9	UTSW	11	66005176	missense	probably benign	0.00
R0973:Dnah9	UTSW	11	66005837	unclassified	probably null
R0974:Dnah9	UTSW	11	66005837	unclassified	probably null
R1055:Dnah9	UTSW	11	66160011	missense	probably damaging	1.00
R1081:Dnah9	UTSW	11	66084877	missense	probably damaging	0.99
R1184:Dnah9	UTSW	11	66084612	critical splice donor site	probably null
R1225:Dnah9	UTSW	11	65871060	missense	possibly damaging	0.94
R1304:Dnah9	UTSW	11	65927588	missense	probably damaging	0.98
R1417:Dnah9	UTSW	11	65955747	missense	probably damaging	0.96
R1439:Dnah9	UTSW	11	65874132	missense	probably benign	0.22
R1447:Dnah9	UTSW	11	66108482	missense	possibly damaging	0.65
R1450:Dnah9	UTSW	11	65927786	missense	probably damaging	1.00
R1470:Dnah9	UTSW	11	65927822	missense	probably benign	0.11
R1470:Dnah9	UTSW	11	65927822	missense	probably benign	0.11
R1486:Dnah9	UTSW	11	65834272	missense	probably damaging	1.00
R1519:Dnah9	UTSW	11	65881761	missense	probably damaging	0.96
R1570:Dnah9	UTSW	11	66112330	missense	probably benign
R1617:Dnah9	UTSW	11	65895921	missense	probably damaging	1.00
R1623:Dnah9	UTSW	11	66037637	missense	probably damaging	1.00
R1626:Dnah9	UTSW	11	66085267	missense	probably benign	0.05
R1671:Dnah9	UTSW	11	65927963	missense	probably damaging	0.99
R1694:Dnah9	UTSW	11	65954824	nonsense	probably null
R1701:Dnah9	UTSW	11	65911924	missense	probably damaging	1.00
R1702:Dnah9	UTSW	11	66085195	missense	possibly damaging	0.72
R1708:Dnah9	UTSW	11	65915154	missense	probably benign	0.11
R1718:Dnah9	UTSW	11	66168079	missense	possibly damaging	0.82
R1729:Dnah9	UTSW	11	66085020	missense	possibly damaging	0.51
R1760:Dnah9	UTSW	11	65981222	missense	probably benign	0.31
R1784:Dnah9	UTSW	11	66085020	missense	possibly damaging	0.51
R1793:Dnah9	UTSW	11	66119594	critical splice donor site	probably null
R1801:Dnah9	UTSW	11	65955297	missense	probably damaging	0.99
R1827:Dnah9	UTSW	11	65850061	missense	probably damaging	0.97
R1836:Dnah9	UTSW	11	66118841	missense	probably benign	0.10
R1840:Dnah9	UTSW	11	65834198	nonsense	probably null
R1847:Dnah9	UTSW	11	65834386	missense	probably damaging	1.00
R1872:Dnah9	UTSW	11	66037490	missense	probably benign	0.16
R1929:Dnah9	UTSW	11	65976398	missense	probably benign	0.05
R1969:Dnah9	UTSW	11	65848371	missense	probably damaging	1.00
R1971:Dnah9	UTSW	11	65848371	missense	probably damaging	1.00
R2027:Dnah9	UTSW	11	65955338	missense	probably benign	0.11
R2049:Dnah9	UTSW	11	66044683	missense	probably damaging	1.00
R2064:Dnah9	UTSW	11	66145435	missense	probably benign	0.31
R2104:Dnah9	UTSW	11	66061124	missense	probably damaging	1.00
R2109:Dnah9	UTSW	11	66037585	missense	probably damaging	1.00
R2160:Dnah9	UTSW	11	66117483	missense	probably damaging	1.00
R2172:Dnah9	UTSW	11	66072779	missense	probably damaging	1.00
R2198:Dnah9	UTSW	11	65859499	missense	possibly damaging	0.50
R2271:Dnah9	UTSW	11	66112362	missense	probably benign	0.37
R2272:Dnah9	UTSW	11	66112362	missense	probably benign	0.37
R2396:Dnah9	UTSW	11	66085158	missense	probably benign	0.01
R2398:Dnah9	UTSW	11	65915203	missense	probably damaging	1.00
R2418:Dnah9	UTSW	11	66095415	nonsense	probably null
R2419:Dnah9	UTSW	11	66095415	nonsense	probably null
R2510:Dnah9	UTSW	11	66005169	missense	probably damaging	1.00
R2680:Dnah9	UTSW	11	66033925	missense	probably benign	0.00
R2875:Dnah9	UTSW	11	66168461	missense	possibly damaging	0.89
R2979:Dnah9	UTSW	11	66117588	missense	possibly damaging	0.89
R3236:Dnah9	UTSW	11	65954989	missense	probably benign	0.11
R3237:Dnah9	UTSW	11	65954989	missense	probably benign	0.11
R3433:Dnah9	UTSW	11	66075112	missense	possibly damaging	0.85
R3737:Dnah9	UTSW	11	66156908	nonsense	probably null
R3820:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3821:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3822:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3861:Dnah9	UTSW	11	66052994	splice site	probably benign
R3918:Dnah9	UTSW	11	65870974	missense	possibly damaging	0.54
R4011:Dnah9	UTSW	11	65834464	missense	probably damaging	0.98
R4044:Dnah9	UTSW	11	66133635	missense	probably benign	0.03
R4072:Dnah9	UTSW	11	66084904	missense	probably benign	0.00
R4076:Dnah9	UTSW	11	66084904	missense	probably benign	0.00
R4097:Dnah9	UTSW	11	65990459	missense	probably damaging	1.00
R4409:Dnah9	UTSW	11	66085477	missense	possibly damaging	0.51
R4410:Dnah9	UTSW	11	66085477	missense	possibly damaging	0.51
R4420:Dnah9	UTSW	11	66118749	missense	probably benign	0.00
R4434:Dnah9	UTSW	11	66108075	missense	possibly damaging	0.67
R4451:Dnah9	UTSW	11	65881641	missense	probably benign	0.07
R4452:Dnah9	UTSW	11	66027082	missense	probably damaging	0.96
R4454:Dnah9	UTSW	11	66147389	missense	probably damaging	0.96
R4551:Dnah9	UTSW	11	65841366	missense	probably damaging	1.00
R4552:Dnah9	UTSW	11	65841366	missense	probably damaging	1.00
R4590:Dnah9	UTSW	11	66040392	missense	probably damaging	1.00
R4595:Dnah9	UTSW	11	66168152	missense	probably benign
R4655:Dnah9	UTSW	11	65955732	missense	probably benign	0.00
R4667:Dnah9	UTSW	11	66155531	missense	probably benign
R4718:Dnah9	UTSW	11	66085473	missense	probably benign
R4720:Dnah9	UTSW	11	66076358	missense	probably damaging	1.00
R4734:Dnah9	UTSW	11	65834115	missense	probably damaging	1.00
R4749:Dnah9	UTSW	11	65834115	missense	probably damaging	1.00
R4765:Dnah9	UTSW	11	65927726	missense	probably damaging	1.00
R4905:Dnah9	UTSW	11	65874124	nonsense	probably null
R4963:Dnah9	UTSW	11	66084611	splice site	probably null
R5074:Dnah9	UTSW	11	65850040	missense	probably damaging	1.00
R5230:Dnah9	UTSW	11	66084666	missense	probably damaging	0.99
R5262:Dnah9	UTSW	11	66112333	missense	probably benign	0.34
R5364:Dnah9	UTSW	11	65881696	missense	possibly damaging	0.93
R5370:Dnah9	UTSW	11	66029354	missense	probably damaging	1.00
R5386:Dnah9	UTSW	11	66029356	missense	probably damaging	1.00
R5389:Dnah9	UTSW	11	66095314	nonsense	probably null
R5541:Dnah9	UTSW	11	66145336	missense	probably damaging	1.00
R5560:Dnah9	UTSW	11	65881740	missense	probably benign	0.00
R5576:Dnah9	UTSW	11	65834096	splice site	probably null
R5648:Dnah9	UTSW	11	65927755	missense	probably benign	0.00
R5653:Dnah9	UTSW	11	65849980	missense	probably damaging	0.99
R5713:Dnah9	UTSW	11	66025223	missense	possibly damaging	0.92
R5763:Dnah9	UTSW	11	65955239	missense	probably damaging	1.00
R5825:Dnah9	UTSW	11	66126601	missense	probably benign	0.01
R5831:Dnah9	UTSW	11	66108121	missense	probably benign	0.00
R5847:Dnah9	UTSW	11	66095240	frame shift	probably null
R5870:Dnah9	UTSW	11	66085210	missense	probably benign	0.01
R5902:Dnah9	UTSW	11	66025187	missense	probably benign	0.08
R5918:Dnah9	UTSW	11	65834199	missense	probably damaging	1.00
R5979:Dnah9	UTSW	11	65834481	missense	probably damaging	1.00
R6065:Dnah9	UTSW	11	65855338	missense	probably benign	0.05
R6065:Dnah9	UTSW	11	66145397	missense	possibly damaging	0.65
R6086:Dnah9	UTSW	11	65989915	missense	probably damaging	0.99
R6086:Dnah9	UTSW	11	66085174	missense	probably benign
R6102:Dnah9	UTSW	11	65990516	missense	probably damaging	0.97
R6120:Dnah9	UTSW	11	66147399	missense	probably benign
R6154:Dnah9	UTSW	11	65855338	missense	probably benign	0.00
R6262:Dnah9	UTSW	11	65881805	splice site	probably null
R6265:Dnah9	UTSW	11	66168094	missense	probably benign	0.04
R6290:Dnah9	UTSW	11	65841375	missense	probably damaging	1.00
R6345:Dnah9	UTSW	11	66037693	missense	probably damaging	0.97
R6357:Dnah9	UTSW	11	65874196	missense	probably damaging	1.00
R6534:Dnah9	UTSW	11	65955248	missense	probably damaging	0.99
R6574:Dnah9	UTSW	11	66168281	missense	probably benign	0.37
R6582:Dnah9	UTSW	11	66061097	missense	probably damaging	1.00
R6700:Dnah9	UTSW	11	65955366	missense	probably damaging	1.00
R6800:Dnah9	UTSW	11	66072739	critical splice donor site	probably null
R6812:Dnah9	UTSW	11	65981329	missense	probably damaging	0.99
R6931:Dnah9	UTSW	11	66117626	missense	possibly damaging	0.63
R6944:Dnah9	UTSW	11	66085149	missense	possibly damaging	0.91
R6958:Dnah9	UTSW	11	66076341	missense	probably damaging	1.00
R6977:Dnah9	UTSW	11	66107909	missense	probably benign	0.37
R7021:Dnah9	UTSW	11	65981231	missense	probably benign
R7161:Dnah9	UTSW	11	65855372	nonsense	probably null
R7175:Dnah9	UTSW	11	66133637	missense	probably benign	0.03
R7199:Dnah9	UTSW	11	66118944	missense	probably benign	0.04
R7231:Dnah9	UTSW	11	65965647	missense	probably damaging	1.00
R7284:Dnah9	UTSW	11	65990476	missense	probably damaging	0.99
R7314:Dnah9	UTSW	11	65989851	missense	probably benign	0.00
R7350:Dnah9	UTSW	11	66080578	missense	probably damaging	1.00
R7420:Dnah9	UTSW	11	66117407	critical splice donor site	probably null
R7427:Dnah9	UTSW	11	65955219	missense	probably benign
R7477:Dnah9	UTSW	11	65992731	missense	probably damaging	0.98
R7515:Dnah9	UTSW	11	65841414	missense	probably benign	0.01
R7521:Dnah9	UTSW	11	65989837	missense	probably damaging	0.98
R7573:Dnah9	UTSW	11	66125215	missense	probably benign	0.43
R7659:Dnah9	UTSW	11	65989780	missense	probably damaging	0.99
R7707:Dnah9	UTSW	11	66118958	missense	probably damaging	1.00
R7749:Dnah9	UTSW	11	65911830	missense	probably damaging	1.00
R7792:Dnah9	UTSW	11	65850013	missense	probably damaging	1.00
R7808:Dnah9	UTSW	11	66005805	nonsense	probably null
R7814:Dnah9	UTSW	11	66005660	missense	probably damaging	1.00
R7818:Dnah9	UTSW	11	66025211	missense	possibly damaging	0.64
V3553:Dnah9	UTSW	11	65970076	missense	probably damaging	1.00
X0027:Dnah9	UTSW	11	66085479	missense	probably benign	0.07
X0028:Dnah9	UTSW	11	65990452	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCTTTGGATCAGATGCTTTC -3'
(R):5'- GTAGCTCTGAGATTTTGTTACCATC -3'

Sequencing Primer
(F):5'- CAGATGCTTTCTAGGGATCCATAG -3'
(R):5'- CTGAGATTTTGTTACCATCATTTGC -3'

Posted On

2015-07-07