Incidental Mutation 'R4417:Kcnj2'
ID326896
Institutional Source Beutler Lab
Gene Symbol Kcnj2
Ensembl Gene ENSMUSG00000041695
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 2
SynonymsIRK1, Kcnf1, Kir2.1
MMRRC Submission 041138-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4417 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location111066164-111076821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111072189 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 136 (S136P)
Ref Sequence ENSEMBL: ENSMUSP00000037192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042970]
PDB Structure
Crystal Structure of Cytoplasmic Domains of IRK1 (Kir2.1) channel [X-RAY DIFFRACTION]
Cytoplasmic Domain Structure of Kir2.1 containing Andersen's Mutation R218Q and Rescue Mutation T309K [X-RAY DIFFRACTION]
Single particle analysis of Kir2.1NC_4 in negative stain [SOLUTION SCATTERING, ELECTRON MICROSCOPY]
Predicted Effect probably damaging
Transcript: ENSMUST00000042970
AA Change: S136P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037192
Gene: ENSMUSG00000041695
AA Change: S136P

DomainStartEndE-ValueType
Pfam:IRK_N 1 47 2.9e-29 PFAM
Pfam:IRK 48 373 7.3e-158 PFAM
Meta Mutation Damage Score 0.9563 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, probably participates in establishing action potential waveform and excitability of neuronal and muscle tissues. Mutations in this gene have been associated with Andersen syndrome, which is characterized by periodic paralysis, cardiac arrhythmias, and dysmorphic features. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation die within 8-12 hours after birth, displaying cyanosis and respiratory distress, as well as complete cleft of the secondary palate, and loss of K+-mediated vasodilatation in cerebral arteries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
BC004004 G A 17: 29,282,275 probably benign Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E61G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Crhbp T C 13: 95,443,877 S65G probably benign Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glp2r T C 11: 67,664,516 probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lcp2 G T 11: 34,050,917 E33D probably benign Het
Lrrc32 G T 7: 98,498,937 R308L probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mfsd12 A G 10: 81,364,703 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Odf2 T A 2: 29,915,321 probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Prdm13 T C 4: 21,678,756 E578G probably benign Het
Pum3 A G 19: 27,422,716 I183T probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Stradb T C 1: 58,994,372 V398A probably benign Het
Tlr4 A T 4: 66,839,303 N111I probably damaging Het
Tnip2 G A 5: 34,503,581 R176* probably null Het
Tomm7 A G 5: 23,843,979 I32T probably benign Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zfp341 T C 2: 154,628,987 L308P possibly damaging Het
Zmym6 T C 4: 127,092,988 S154P probably damaging Het
Other mutations in Kcnj2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Kcnj2 APN 11 111071827 missense probably damaging 1.00
IGL02448:Kcnj2 APN 11 111072282 missense probably benign 0.00
R0090:Kcnj2 UTSW 11 111073027 missense probably benign 0.02
R1162:Kcnj2 UTSW 11 111072967 missense probably benign
R1990:Kcnj2 UTSW 11 111072883 missense probably benign 0.00
R3948:Kcnj2 UTSW 11 111072655 missense possibly damaging 0.73
R4605:Kcnj2 UTSW 11 111072850 missense probably damaging 1.00
R5191:Kcnj2 UTSW 11 111072471 nonsense probably null
R5439:Kcnj2 UTSW 11 111072231 missense probably damaging 1.00
R5530:Kcnj2 UTSW 11 111072091 missense probably damaging 1.00
R6167:Kcnj2 UTSW 11 111072489 missense probably benign
R7126:Kcnj2 UTSW 11 111072822 missense probably damaging 1.00
R7713:Kcnj2 UTSW 11 111072483 missense probably benign 0.00
R8007:Kcnj2 UTSW 11 111073058 missense probably benign 0.24
X0052:Kcnj2 UTSW 11 111071856 missense probably benign 0.13
Z1176:Kcnj2 UTSW 11 111072135 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTACTACCTGTGTCGACATCCG -3'
(R):5'- AGAGTTTGCCATCCCTCATG -3'

Sequencing Primer
(F):5'- TGTGTCGACATCCGCTGGAG -3'
(R):5'- TCATGGCAATCACAGCATTG -3'
Posted On2015-07-07