Incidental Mutation 'R4417:Crhbp'
ID326899
Institutional Source Beutler Lab
Gene Symbol Crhbp
Ensembl Gene ENSMUSG00000021680
Gene Namecorticotropin releasing hormone binding protein
SynonymsCRH-BP
MMRRC Submission 041138-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R4417 (G1)
Quality Score205
Status Validated
Chromosome13
Chromosomal Location95431371-95444924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95443877 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 65 (S65G)
Ref Sequence ENSEMBL: ENSMUSP00000152083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045583] [ENSMUST00000221025]
Predicted Effect probably benign
Transcript: ENSMUST00000045583
AA Change: S72G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000042578
Gene: ENSMUSG00000021680
AA Change: S72G

DomainStartEndE-ValueType
Pfam:CRF-BP 1 307 1.1e-179 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221025
AA Change: S65G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.1845 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Corticotropin-releasing hormone is a potent stimulator of synthesis and secretion of preopiomelanocortin-derived peptides. Although CRH concentrations in the human peripheral circulation are normally low, they increase throughout pregnancy and fall rapidly after parturition. Maternal plasma CRH probably originates from the placenta. Human plasma contains a CRH-binding protein which inactivates CRH and which may prevent inappropriate pituitary-adrenal stimulation in pregnancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display behavior indicative of increased anxiety. Male mice also show reduced food intake resulting in reduced growth between ages 7 and 15 weeks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
BC004004 G A 17: 29,282,275 probably benign Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E61G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glp2r T C 11: 67,664,516 probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Kcnj2 T C 11: 111,072,189 S136P probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lcp2 G T 11: 34,050,917 E33D probably benign Het
Lrrc32 G T 7: 98,498,937 R308L probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mfsd12 A G 10: 81,364,703 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Odf2 T A 2: 29,915,321 probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Prdm13 T C 4: 21,678,756 E578G probably benign Het
Pum3 A G 19: 27,422,716 I183T probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Stradb T C 1: 58,994,372 V398A probably benign Het
Tlr4 A T 4: 66,839,303 N111I probably damaging Het
Tnip2 G A 5: 34,503,581 R176* probably null Het
Tomm7 A G 5: 23,843,979 I32T probably benign Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zfp341 T C 2: 154,628,987 L308P possibly damaging Het
Zmym6 T C 4: 127,092,988 S154P probably damaging Het
Other mutations in Crhbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Crhbp APN 13 95443787 missense probably damaging 0.96
IGL03058:Crhbp APN 13 95443798 missense probably damaging 1.00
R0518:Crhbp UTSW 13 95443895 critical splice acceptor site probably null
R0521:Crhbp UTSW 13 95443895 critical splice acceptor site probably null
R1120:Crhbp UTSW 13 95442085 missense probably benign 0.01
R4925:Crhbp UTSW 13 95443810 missense possibly damaging 0.93
R4999:Crhbp UTSW 13 95442245 missense probably damaging 1.00
R5332:Crhbp UTSW 13 95436455 missense probably damaging 0.99
R5568:Crhbp UTSW 13 95442229 missense probably damaging 1.00
R5857:Crhbp UTSW 13 95442232 missense probably benign 0.01
R5861:Crhbp UTSW 13 95443825 missense probably damaging 1.00
R5875:Crhbp UTSW 13 95443796 missense probably benign 0.00
R5911:Crhbp UTSW 13 95432056 missense probably benign 0.00
R6235:Crhbp UTSW 13 95443850 missense probably damaging 1.00
R7038:Crhbp UTSW 13 95444191 missense probably damaging 1.00
R7885:Crhbp UTSW 13 95432007 missense probably damaging 0.96
R8479:Crhbp UTSW 13 95442124 missense possibly damaging 0.94
X0052:Crhbp UTSW 13 95431993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTTAGAGGTTTAGTTGTCCC -3'
(R):5'- GCTTGCAGGATATCTGGTCG -3'

Sequencing Primer
(F):5'- AGAGGTTTAGTTGTCCCCCACATG -3'
(R):5'- TGGGTTGCAGCATCCAC -3'
Posted On2015-07-07