Incidental Mutation 'R0016:Slc7a1'
ID32690
Institutional Source Beutler Lab
Gene Symbol Slc7a1
Ensembl Gene ENSMUSG00000041313
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 1
SynonymsRev-1, Rec-1, Atrc1, Cat1, mCAT-1, 4831426K01Rik, Atrc-1
MMRRC Submission 038311-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0016 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location148327410-148399904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148334583 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 522 (V522A)
Ref Sequence ENSEMBL: ENSMUSP00000117781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048116] [ENSMUST00000138257]
Predicted Effect probably benign
Transcript: ENSMUST00000048116
AA Change: V522A

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000046714
Gene: ENSMUSG00000041313
AA Change: V522A

DomainStartEndE-ValueType
Pfam:AA_permease_2 32 440 1.3e-51 PFAM
Pfam:AA_permease 36 431 1.3e-42 PFAM
transmembrane domain 487 509 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Pfam:AA_permease_C 551 601 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138257
AA Change: V522A

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000117781
Gene: ENSMUSG00000041313
AA Change: V522A

DomainStartEndE-ValueType
Pfam:AA_permease_2 32 439 6e-52 PFAM
Pfam:AA_permease 36 433 2.3e-43 PFAM
transmembrane domain 487 509 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Meta Mutation Damage Score 0.2672 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Homozygous mutants die on the first day of birth and are very anemic. Peripheral blood contains 50% fewer red blood cells, reduced hemoglobin levels, and a defect in erythroid maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,294,800 V1181G probably benign Het
Adamts12 A T 15: 11,217,829 I291F probably damaging Het
Aspm G C 1: 139,479,544 Q2056H probably benign Het
BC067074 T C 13: 113,366,105 Y115H probably damaging Het
C7 A T 15: 5,046,924 V122E probably benign Het
Casp12 A T 9: 5,352,844 Q152L probably null Het
Cdh16 T A 8: 104,617,632 T92S probably benign Het
Chrd G C 16: 20,734,308 V162L possibly damaging Het
Cpne8 A G 15: 90,501,405 probably benign Het
Cyp2j7 T A 4: 96,202,147 I347F probably damaging Het
Cyp4a10 A T 4: 115,521,107 Q130L probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Dgkd T C 1: 87,917,952 S294P probably benign Het
Dnah8 A G 17: 30,663,316 I621V probably benign Het
Dync2h1 A G 9: 7,144,346 probably benign Het
Echdc1 A T 10: 29,322,421 probably benign Het
Elovl3 T A 19: 46,132,158 F30Y probably damaging Het
Fa2h T C 8: 111,393,514 Y80C probably damaging Het
Fam208b A C 13: 3,585,170 probably null Het
Fgd3 C T 13: 49,296,609 D55N probably benign Het
Fhod1 T C 8: 105,331,655 E823G possibly damaging Het
Gapvd1 A G 2: 34,699,913 probably benign Het
Gm17067 A T 7: 42,708,622 I152K probably benign Het
Gm1966 G A 7: 106,603,246 L264F probably benign Het
Gm9833 A T 3: 10,089,319 M383L possibly damaging Het
Kif27 A G 13: 58,354,714 V50A probably damaging Het
Kpna2 T C 11: 106,991,086 T305A probably benign Het
Krtap22-2 A G 16: 89,010,519 probably benign Het
Lrp2bp T A 8: 46,012,031 F62L probably damaging Het
Marf1 G A 16: 14,152,265 H197Y probably damaging Het
Mob3b A G 4: 35,083,947 F81L probably benign Het
Mon2 C T 10: 123,035,546 V389M probably damaging Het
Myh8 A G 11: 67,298,525 K1176E probably damaging Het
Naf1 T C 8: 66,889,055 probably benign Het
Nckap1l A G 15: 103,475,636 T554A probably benign Het
Oog3 A G 4: 144,158,071 Y432H probably damaging Het
Paxbp1 A T 16: 91,036,036 probably benign Het
Phf20 A T 2: 156,267,194 K154* probably null Het
Plekhj1 T C 10: 80,796,416 D74G possibly damaging Het
Plpp4 T C 7: 129,323,424 C128R probably damaging Het
Rcan3 A T 4: 135,418,378 probably null Het
Sh3rf1 T A 8: 61,374,138 M642K probably benign Het
Sorbs1 A G 19: 40,314,738 probably benign Het
Spry2 C T 14: 105,893,297 V152M probably benign Het
Srgap2 A G 1: 131,349,462 M349T possibly damaging Het
Stag3 A G 5: 138,291,381 H271R possibly damaging Het
Stat4 T C 1: 52,068,780 V136A probably benign Het
Stc2 A T 11: 31,360,177 D286E probably benign Het
Stk31 T C 6: 49,437,377 Y482H probably damaging Het
Ticrr C T 7: 79,693,792 P1135L probably benign Het
Tmem55b C T 14: 50,928,894 R213Q probably damaging Het
Trim27 A T 13: 21,191,229 E310V probably benign Het
Uvrag T C 7: 98,991,981 K284R probably benign Het
Vmn1r78 A C 7: 12,153,352 S297R probably benign Het
Xylt2 A G 11: 94,669,640 S270P probably damaging Het
Zfhx3 T C 8: 108,950,178 M2620T probably benign Het
Zkscan2 C A 7: 123,499,996 probably benign Het
Zwint T C 10: 72,657,198 probably benign Het
Other mutations in Slc7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Slc7a1 APN 5 148337192 missense possibly damaging 0.61
H8441:Slc7a1 UTSW 5 148334545 missense probably benign 0.17
R0028:Slc7a1 UTSW 5 148335511 missense probably benign 0.00
R0103:Slc7a1 UTSW 5 148352426 nonsense probably null
R0103:Slc7a1 UTSW 5 148352426 nonsense probably null
R0565:Slc7a1 UTSW 5 148352069 missense probably damaging 1.00
R0696:Slc7a1 UTSW 5 148340556 missense probably benign 0.11
R1338:Slc7a1 UTSW 5 148345936 missense probably damaging 1.00
R1539:Slc7a1 UTSW 5 148335593 missense possibly damaging 0.95
R1926:Slc7a1 UTSW 5 148348303 missense probably damaging 1.00
R2895:Slc7a1 UTSW 5 148340592 missense probably benign 0.06
R2910:Slc7a1 UTSW 5 148352257 missense probably benign 0.00
R3721:Slc7a1 UTSW 5 148335533 nonsense probably null
R3722:Slc7a1 UTSW 5 148335533 nonsense probably null
R4028:Slc7a1 UTSW 5 148345812 missense probably benign 0.01
R4114:Slc7a1 UTSW 5 148342057 missense probably damaging 1.00
R4510:Slc7a1 UTSW 5 148340562 missense probably damaging 1.00
R4511:Slc7a1 UTSW 5 148340562 missense probably damaging 1.00
R4600:Slc7a1 UTSW 5 148342059 missense probably damaging 1.00
R4657:Slc7a1 UTSW 5 148352399 missense probably benign
R4723:Slc7a1 UTSW 5 148335440 missense probably damaging 0.99
R5248:Slc7a1 UTSW 5 148333988 missense possibly damaging 0.91
R5697:Slc7a1 UTSW 5 148333982 missense probably benign 0.00
R6027:Slc7a1 UTSW 5 148333964 missense possibly damaging 0.94
R6370:Slc7a1 UTSW 5 148340673 missense probably damaging 1.00
R6847:Slc7a1 UTSW 5 148334658 missense probably benign
R7007:Slc7a1 UTSW 5 148352446
R7635:Slc7a1 UTSW 5 148352236 missense probably damaging 0.99
V1024:Slc7a1 UTSW 5 148334545 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GGGTCACCTCCAAGGCCAAACAAT -3'
(R):5'- AGCCGCTCTTATCATCACCGTGT -3'

Sequencing Primer
(F):5'- GTTCAGCTTTCTTACAGAAAAAAACC -3'
(R):5'- ccctgtactggggcatataaag -3'
Posted On2013-05-09