Incidental Mutation 'R4417:Pum3'
ID326907
Institutional Source Beutler Lab
Gene Symbol Pum3
Ensembl Gene ENSMUSG00000041360
Gene Namepumilio RNA-binding family member 3
Synonyms1110069H02Rik, D19Bwg1357e
MMRRC Submission 041138-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.892) question?
Stock #R4417 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location27388702-27429820 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27422716 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 183 (I183T)
Ref Sequence ENSEMBL: ENSMUSP00000075573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076219]
Predicted Effect probably damaging
Transcript: ENSMUST00000076219
AA Change: I183T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075573
Gene: ENSMUSG00000041360
AA Change: I183T

DomainStartEndE-ValueType
low complexity region 106 121 N/A INTRINSIC
Pumilio 165 200 1.8e-3 SMART
Pumilio 201 236 1.36e-3 SMART
Pumilio 237 273 3.72e0 SMART
Pumilio 350 385 2.54e-3 SMART
Pumilio 386 422 7.89e0 SMART
Pumilio 424 460 5.5e0 SMART
Meta Mutation Damage Score 0.3807 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: This gene encodes a member of the evolutionarily conserved Pumilio and Fem-3 mRNA-binding factor family of proteins, which are characterized by tandem 36 amino acid pumilio homolog domains and which function in diverse biological processes. This protein belongs to a group of atypical Pumilio and Fem-3 mRNA-binding factor proteins, whose members are distinguished from other Pumilio and Fem-3 mRNA-binding factor proteins by a novel protein fold with 11 pumilio homolog domains and an ability to bind to DNA and single- and double-stranded RNA without sequence specificity. In mouse, lower levels of gene expression have been correlated with increased testicular germ cell tumors. A pseudogene of this gene is found on chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
A630001G21Rik T A 1: 85,726,463 Y51F probably damaging Het
Abi3bp C A 16: 56,654,035 T631K probably damaging Het
BC004004 G A 17: 29,282,275 probably benign Het
Cabp1 G A 5: 115,186,037 S7L possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Col28a1 T A 6: 8,175,666 I61F possibly damaging Het
Col2a1 T C 15: 97,998,585 E61G unknown Het
Col6a4 C T 9: 106,072,016 V807I probably damaging Het
Crhbp T C 13: 95,443,877 S65G probably benign Het
Dnah9 T A 11: 65,981,214 Q2730L possibly damaging Het
Epx T A 11: 87,869,430 R453* probably null Het
Fez1 T C 9: 36,870,472 probably benign Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Glp2r T C 11: 67,664,516 probably benign Het
Gm1141 G A X: 71,939,619 C399Y possibly damaging Het
Gpm6a T A 8: 55,050,188 N157K probably damaging Het
Kcnj2 T C 11: 111,072,189 S136P probably damaging Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lcp2 G T 11: 34,050,917 E33D probably benign Het
Lrrc32 G T 7: 98,498,937 R308L probably benign Het
Matr3 C A 18: 35,572,118 A32D probably damaging Het
Mfsd12 A G 10: 81,364,703 probably benign Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Notch2 A G 3: 98,131,270 D1243G possibly damaging Het
Odf2 T A 2: 29,915,321 probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Olfr1233 T C 2: 89,339,987 E105G probably benign Het
Pitpnm2 G T 5: 124,123,569 R977S probably damaging Het
Prdm13 T C 4: 21,678,756 E578G probably benign Het
Rdh14 G A 12: 10,391,231 probably null Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Slit1 A G 19: 41,614,469 C968R probably damaging Het
Spag9 A T 11: 94,060,346 probably benign Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Stradb T C 1: 58,994,372 V398A probably benign Het
Tlr4 A T 4: 66,839,303 N111I probably damaging Het
Tnip2 G A 5: 34,503,581 R176* probably null Het
Tomm7 A G 5: 23,843,979 I32T probably benign Het
Trank1 T C 9: 111,365,968 I1020T probably benign Het
Ugt1a10 T G 1: 88,055,995 S172A probably benign Het
Vmn2r115 T A 17: 23,345,880 M247K probably benign Het
Zfp341 T C 2: 154,628,987 L308P possibly damaging Het
Zmym6 T C 4: 127,092,988 S154P probably damaging Het
Other mutations in Pum3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00795:Pum3 APN 19 27422358 missense probably damaging 0.96
IGL02368:Pum3 APN 19 27425957 missense probably benign 0.00
IGL03036:Pum3 APN 19 27421313 missense probably damaging 0.96
IGL03177:Pum3 APN 19 27390212 missense probably benign 0.29
R0242:Pum3 UTSW 19 27422755 splice site probably benign
R1480:Pum3 UTSW 19 27398910 missense probably benign 0.04
R2860:Pum3 UTSW 19 27420125 splice site probably benign
R4576:Pum3 UTSW 19 27415908 missense probably benign 0.32
R5145:Pum3 UTSW 19 27399769 missense probably damaging 1.00
R5439:Pum3 UTSW 19 27412259 missense probably benign 0.27
R5473:Pum3 UTSW 19 27418848 missense probably damaging 0.99
R5733:Pum3 UTSW 19 27421295 critical splice donor site probably null
R5964:Pum3 UTSW 19 27420051 missense probably damaging 0.96
R6516:Pum3 UTSW 19 27426008 missense probably benign
R7184:Pum3 UTSW 19 27426012 missense probably benign 0.03
R7216:Pum3 UTSW 19 27424225 missense probably damaging 1.00
R7376:Pum3 UTSW 19 27394328 missense probably benign 0.00
R7390:Pum3 UTSW 19 27424242 missense probably benign 0.11
R7761:Pum3 UTSW 19 27427092 missense probably benign
R7881:Pum3 UTSW 19 27396328 nonsense probably null
R7964:Pum3 UTSW 19 27396328 nonsense probably null
X0009:Pum3 UTSW 19 27422702 nonsense probably null
X0063:Pum3 UTSW 19 27425794 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAAGCATGTCAGCACTCTGC -3'
(R):5'- AAGCAGTAGTCCACGCAGTC -3'

Sequencing Primer
(F):5'- TCTCACTGCAGTGCCCAGAG -3'
(R):5'- GGATGGTGATAGTATCTTCCCATCTC -3'
Posted On2015-07-07