Mutagenetix > Incidental Mutation

Incidental Mutation 'R4418:Plxna2'

326914

Institutional Source

Beutler Lab

Gene Symbol

Plxna2

Ensembl Gene

ENSMUSG00000026640

Gene Name

plexin A2

Synonyms

2810428A13Rik, OCT, PlexA2, Plxn2

MMRRC Submission

041139-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4418 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

194618218-194816869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 194749317 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 538 (S538F)

Ref Sequence

ENSEMBL: ENSMUSP00000027952 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027952]

AlphaFold

P70207

PDB Structure

Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027952
AA Change: S538F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: S538F

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
Sema	50	492	1.65e-132	SMART
PSI	510	560	8e-12	SMART
PSI	655	702	6.35e-6	SMART
PSI	803	856	1.24e-8	SMART
IPT	857	952	6.36e-21	SMART
IPT	953	1038	1.02e-24	SMART
IPT	1040	1140	1.48e-21	SMART
IPT	1142	1237	8.81e-6	SMART
transmembrane domain	1238	1260	N/A	INTRINSIC
Pfam:Plexin_cytopl	1311	1864	1.9e-261	PFAM

Meta Mutation Damage Score

0.7688

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

95% (72/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	C	18: 38,261,287		probably null	Het
4930523C07Rik	A	G	1: 160,044,802		noncoding transcript	Het
5430419D17Rik	A	T	7: 131,247,465	D899V	possibly damaging	Het
Acot12	A	G	13: 91,784,405	T507A	possibly damaging	Het
Agap2	T	G	10: 127,091,650	C1113W	probably damaging	Het
Ap3s1-ps2	A	T	8: 94,405,293		noncoding transcript	Het
B3gnt3	T	C	8: 71,693,769	R39G	probably benign	Het
Bahd1	G	A	2: 118,922,523	R757H	probably damaging	Het
Chad	C	T	11: 94,567,837	H271Y	possibly damaging	Het
Chil4	G	A	3: 106,203,727	P284S	possibly damaging	Het
Col6a1	T	A	10: 76,718,405	K323*	probably null	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dclre1c	T	C	2: 3,452,935	F285S	possibly damaging	Het
Dctn2	T	G	10: 127,278,365	M360R	probably benign	Het
Dgka	A	T	10: 128,728,094	L462Q	probably damaging	Het
Drg2	A	C	11: 60,468,146	K364T	probably damaging	Het
Dync1li1	T	A	9: 114,706,170	S167R	probably damaging	Het
Fam189a2	T	C	19: 23,979,435	T365A	probably benign	Het
Fer	A	T	17: 64,029,291	D554V	possibly damaging	Het
Fignl2	A	G	15: 101,053,949	S151P	possibly damaging	Het
Gbgt1	A	G	2: 28,498,408	Y35C	probably damaging	Het
Gm6526	T	A	14: 43,748,845	I79K	probably damaging	Het
Gm884	T	C	11: 103,618,314		probably benign	Het
Gpr6	T	G	10: 41,070,608	N326T	probably damaging	Het
Hcn4	C	T	9: 58,843,895	T268M	probably benign	Het
Hist1h2bc	C	T	13: 23,684,503	T91M	probably damaging	Het
Hnf4g	A	G	3: 3,648,094	M243V	possibly damaging	Het
Homer1	A	G	13: 93,402,069	E314G	probably damaging	Het
Hs6st1	T	C	1: 36,104,027	Y348H	probably damaging	Het
Ifitm6	A	T	7: 141,016,071	I103N	probably damaging	Het
Ipo5	T	G	14: 120,943,893	C944G	possibly damaging	Het
Kcnb1	C	A	2: 167,105,675	E418*	probably null	Het
Kcnk2	G	A	1: 189,256,727	R207C	probably damaging	Het
Kctd8	T	C	5: 69,341,162	E47G	probably damaging	Het
Klhdc2	C	T	12: 69,307,597		probably benign	Het
Mgat1	A	G	11: 49,261,245	Y185C	probably damaging	Het
Mmp25	T	A	17: 23,644,070	R122S	probably damaging	Het
Mrpl39	C	A	16: 84,725,124		probably null	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Nek1	T	C	8: 61,106,864	F1007S	probably damaging	Het
Neto1	T	C	18: 86,404,856	M146T	probably benign	Het
Opn1sw	G	A	6: 29,379,424	R45*	probably null	Het
Osbpl5	A	T	7: 143,709,815	C98*	probably null	Het
Pcdhb7	C	T	18: 37,343,482	A557V	probably benign	Het
Pecam1	A	G	11: 106,695,922	F155L	possibly damaging	Het
Pmfbp1	C	A	8: 109,530,633	Q609K	probably benign	Het
Pnpo	A	T	11: 96,940,969		probably null	Het
Ppp2cb	G	A	8: 33,617,049	R254Q	probably benign	Het
Qser1	A	T	2: 104,789,421	S349T	probably damaging	Het
Rnf167	T	A	11: 70,647,917	W17R	probably damaging	Het
Rpl21-ps4	A	G	14: 11,227,879		noncoding transcript	Het
Rxfp2	A	T	5: 150,048,800	H158L	probably benign	Het
Ryr3	C	T	2: 112,831,224	C1807Y	probably damaging	Het
Scaper	T	A	9: 55,838,180	E601D	probably damaging	Het
Secisbp2l	A	T	2: 125,752,915	C542S	probably benign	Het
Slc6a19	A	G	13: 73,684,395	V393A	possibly damaging	Het
Stil	A	G	4: 115,009,377	N176S	probably benign	Het
Tap1	T	A	17: 34,188,379		probably null	Het
Tcl1b3	A	T	12: 105,193,585	Q105L	probably damaging	Het
Tmem206	T	A	1: 191,348,432	V283E	probably damaging	Het
Trappc10	G	T	10: 78,217,188	A251D	probably damaging	Het
Trim43a	G	T	9: 88,582,153	C39F	probably damaging	Het
Ttn	A	T	2: 76,889,481		probably benign	Het
Vmn2r110	A	T	17: 20,583,689	L208*	probably null	Het
Vmn2r88	G	T	14: 51,418,081	L583F	probably damaging	Het
Wasf1	C	T	10: 40,936,582	H456Y	unknown	Het
Zfp120	A	G	2: 150,118,185	I73T	possibly damaging	Het
Zfp990	T	C	4: 145,536,728	C99R	possibly damaging	Het

Other mutations in Plxna2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Plxna2	APN	1	194644657	missense	probably damaging	1.00
IGL00332:Plxna2	APN	1	194789830	missense	probably damaging	0.98
IGL00392:Plxna2	APN	1	194800568	missense	probably damaging	1.00
IGL00432:Plxna2	APN	1	194644096	missense	probably benign	0.03
IGL00704:Plxna2	APN	1	194751461	missense	probably damaging	0.99
IGL00737:Plxna2	APN	1	194746239	splice site	probably benign
IGL01078:Plxna2	APN	1	194786693	unclassified	probably benign
IGL01354:Plxna2	APN	1	194762435	missense	probably benign	0.02
IGL01432:Plxna2	APN	1	194644318	missense	possibly damaging	0.58
IGL01459:Plxna2	APN	1	194764570	missense	probably benign	0.00
IGL01525:Plxna2	APN	1	194712311	missense	probably benign	0.00
IGL01656:Plxna2	APN	1	194790161	missense	possibly damaging	0.52
IGL01825:Plxna2	APN	1	194788902	missense	probably damaging	0.98
IGL01862:Plxna2	APN	1	194643950	missense	possibly damaging	0.87
IGL01899:Plxna2	APN	1	194751488	missense	probably damaging	1.00
IGL01996:Plxna2	APN	1	194799776	missense	probably damaging	0.99
IGL02123:Plxna2	APN	1	194794383	missense	probably damaging	1.00
IGL02226:Plxna2	APN	1	194644424	missense	probably damaging	1.00
IGL02227:Plxna2	APN	1	194752089	missense	probably damaging	1.00
IGL02415:Plxna2	APN	1	194643964	missense	probably damaging	1.00
IGL02440:Plxna2	APN	1	194746150	missense	probably benign	0.10
IGL02545:Plxna2	APN	1	194786690	unclassified	probably benign
IGL02553:Plxna2	APN	1	194751438	missense	probably benign	0.08
IGL02882:Plxna2	APN	1	194762570	missense	probably damaging	1.00
IGL02946:Plxna2	APN	1	194749309	splice site	probably benign
IGL03062:Plxna2	APN	1	194762550	missense	possibly damaging	0.72
IGL03095:Plxna2	APN	1	194801127	missense	probably damaging	1.00
IGL03293:Plxna2	APN	1	194804945	missense	probably damaging	0.99
G1Funyon:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
PIT4514001:Plxna2	UTSW	1	194794937	missense	probably benign	0.00
R0024:Plxna2	UTSW	1	194643995	missense	possibly damaging	0.57
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0217:Plxna2	UTSW	1	194644598	missense	probably damaging	1.00
R0316:Plxna2	UTSW	1	194644150	missense	probably damaging	1.00
R0440:Plxna2	UTSW	1	194644404	nonsense	probably null
R0505:Plxna2	UTSW	1	194644348	missense	possibly damaging	0.93
R0568:Plxna2	UTSW	1	194751386	missense	probably benign	0.00
R0669:Plxna2	UTSW	1	194788837	missense	probably damaging	0.99
R0674:Plxna2	UTSW	1	194649475	missense	probably benign	0.00
R0885:Plxna2	UTSW	1	194644556	missense	probably benign
R0898:Plxna2	UTSW	1	194797024	missense	probably damaging	1.00
R0940:Plxna2	UTSW	1	194800555	missense	probably benign	0.01
R1061:Plxna2	UTSW	1	194644093	missense	probably damaging	1.00
R1067:Plxna2	UTSW	1	194780510	splice site	probably null
R1222:Plxna2	UTSW	1	194800649	missense	probably damaging	1.00
R1345:Plxna2	UTSW	1	194644486	missense	probably damaging	1.00
R1363:Plxna2	UTSW	1	194804939	nonsense	probably null
R1432:Plxna2	UTSW	1	194767463	missense	probably benign	0.10
R1434:Plxna2	UTSW	1	194751540	splice site	probably benign
R1597:Plxna2	UTSW	1	194749306	splice site	probably benign
R1719:Plxna2	UTSW	1	194644370	missense	possibly damaging	0.93
R1778:Plxna2	UTSW	1	194810970	missense	probably benign	0.01
R1795:Plxna2	UTSW	1	194806303	missense	probably damaging	0.99
R1819:Plxna2	UTSW	1	194790186	missense	probably benign	0.03
R1926:Plxna2	UTSW	1	194762450	missense	probably benign	0.02
R1966:Plxna2	UTSW	1	194644700	missense	possibly damaging	0.91
R1987:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R1988:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R2034:Plxna2	UTSW	1	194780594	missense	probably benign	0.00
R2131:Plxna2	UTSW	1	194644750	missense	probably benign	0.01
R2171:Plxna2	UTSW	1	194800617	missense	probably damaging	1.00
R2217:Plxna2	UTSW	1	194797748	missense	probably damaging	1.00
R2311:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2340:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2342:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2423:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2424:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2425:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2842:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2971:Plxna2	UTSW	1	194797731	missense	probably damaging	1.00
R3236:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3731:Plxna2	UTSW	1	194788885	missense	probably benign	0.42
R3783:Plxna2	UTSW	1	194807521	missense	probably damaging	1.00
R3784:Plxna2	UTSW	1	194644617	missense	probably benign
R3787:Plxna2	UTSW	1	194643934	missense	probably benign	0.10
R3845:Plxna2	UTSW	1	194793790	missense	probably damaging	0.96
R3927:Plxna2	UTSW	1	194746157	missense	probably benign	0.02
R3930:Plxna2	UTSW	1	194794910	missense	probably benign	0.17
R3964:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3980:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4067:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4120:Plxna2	UTSW	1	194780627	missense	probably damaging	1.00
R4231:Plxna2	UTSW	1	194644454	missense	probably damaging	1.00
R4257:Plxna2	UTSW	1	194644775	missense	probably damaging	1.00
R4396:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4397:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4444:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4446:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4482:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4487:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4489:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4571:Plxna2	UTSW	1	194810988	missense	possibly damaging	0.91
R4622:Plxna2	UTSW	1	194812150	missense	probably benign
R4623:Plxna2	UTSW	1	194812150	missense	probably benign
R4684:Plxna2	UTSW	1	194762594	missense	probably benign	0.42
R4688:Plxna2	UTSW	1	194644445	missense	probably damaging	1.00
R4855:Plxna2	UTSW	1	194797732	missense	probably benign	0.39
R4876:Plxna2	UTSW	1	194643775	missense	probably benign	0.02
R5161:Plxna2	UTSW	1	194751404	missense	probably benign
R5207:Plxna2	UTSW	1	194788899	missense	probably benign	0.19
R5479:Plxna2	UTSW	1	194793873	missense	probably benign
R5931:Plxna2	UTSW	1	194810870	missense	probably damaging	1.00
R6026:Plxna2	UTSW	1	194799814	missense	probably damaging	1.00
R6029:Plxna2	UTSW	1	194794427	missense	probably benign	0.00
R6029:Plxna2	UTSW	1	194799575	missense	probably damaging	1.00
R6059:Plxna2	UTSW	1	194810971	missense	possibly damaging	0.79
R6238:Plxna2	UTSW	1	194790196	missense	probably benign	0.01
R6322:Plxna2	UTSW	1	194754367	missense	possibly damaging	0.89
R6668:Plxna2	UTSW	1	194810088	missense	possibly damaging	0.68
R6709:Plxna2	UTSW	1	194789766	missense	probably benign	0.01
R6748:Plxna2	UTSW	1	194794182	splice site	probably null
R6838:Plxna2	UTSW	1	194804914	missense	possibly damaging	0.90
R6844:Plxna2	UTSW	1	194793828	missense	probably benign	0.08
R7069:Plxna2	UTSW	1	194793904	missense	possibly damaging	0.51
R7122:Plxna2	UTSW	1	194644568	nonsense	probably null
R7145:Plxna2	UTSW	1	194649522	missense	probably benign	0.31
R7189:Plxna2	UTSW	1	194801058	missense	possibly damaging	0.58
R7207:Plxna2	UTSW	1	194644019	missense	probably damaging	1.00
R7232:Plxna2	UTSW	1	194712260	missense	probably damaging	1.00
R7234:Plxna2	UTSW	1	194806390	missense	probably damaging	0.96
R7246:Plxna2	UTSW	1	194644282	missense	possibly damaging	0.74
R7255:Plxna2	UTSW	1	194752103	missense	probably benign	0.03
R7283:Plxna2	UTSW	1	194644883	missense	probably damaging	0.99
R7288:Plxna2	UTSW	1	194796919	missense	probably damaging	1.00
R7361:Plxna2	UTSW	1	194799779	missense	probably damaging	1.00
R7424:Plxna2	UTSW	1	194806339	missense	probably damaging	0.98
R7501:Plxna2	UTSW	1	194643895	missense	possibly damaging	0.95
R7528:Plxna2	UTSW	1	194812156	missense	probably damaging	1.00
R7529:Plxna2	UTSW	1	194643871	missense	probably benign	0.25
R7532:Plxna2	UTSW	1	194644819	missense	probably benign	0.13
R7959:Plxna2	UTSW	1	194793864	frame shift	probably null
R7959:Plxna2	UTSW	1	194810962	missense	probably damaging	1.00
R7960:Plxna2	UTSW	1	194793864	frame shift	probably null
R8261:Plxna2	UTSW	1	194749416	missense	probably damaging	1.00
R8301:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
R8463:Plxna2	UTSW	1	194644046	missense	probably damaging	1.00
R8519:Plxna2	UTSW	1	194793958	missense	probably damaging	1.00
R8836:Plxna2	UTSW	1	194796935	missense	possibly damaging	0.94
R9010:Plxna2	UTSW	1	194788909	missense	possibly damaging	0.95
R9034:Plxna2	UTSW	1	194793889	missense	probably damaging	1.00
R9254:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9274:Plxna2	UTSW	1	194788828	missense	probably damaging	1.00
R9379:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9385:Plxna2	UTSW	1	194749416	missense	possibly damaging	0.95
R9422:Plxna2	UTSW	1	194644422	missense	probably damaging	1.00
R9451:Plxna2	UTSW	1	194644384	missense	probably benign	0.05
R9484:Plxna2	UTSW	1	194644894	missense	probably damaging	1.00
X0027:Plxna2	UTSW	1	194644433	missense	probably damaging	1.00
Z1088:Plxna2	UTSW	1	194644441	missense	possibly damaging	0.56
Z1088:Plxna2	UTSW	1	194764539	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- AGAGCTGTCCTTCTTAAGTACCC -3'
(R):5'- AAAAGAAGTTTGCTCTGTGCTC -3'

Sequencing Primer
(F):5'- AACCAGCATCTTGGCTTGG -3'
(R):5'- TCTGTGCTCCGGTCGGTC -3'

Posted On

2015-07-07