Incidental Mutation 'R4418:Dync1li1'
ID326944
Institutional Source Beutler Lab
Gene Symbol Dync1li1
Ensembl Gene ENSMUSG00000032435
Gene Namedynein cytoplasmic 1 light intermediate chain 1
SynonymsDnclic1, 1110053F02Rik, LIC-1
MMRRC Submission 041139-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.780) question?
Stock #R4418 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location114688790-114724302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114706170 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 167 (S167R)
Ref Sequence ENSEMBL: ENSMUSP00000035366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047404]
Predicted Effect probably damaging
Transcript: ENSMUST00000047404
AA Change: S167R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035366
Gene: ENSMUSG00000032435
AA Change: S167R

DomainStartEndE-ValueType
Pfam:DLIC 43 519 2.7e-258 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215345
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (72/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to light intermediate subunit family, whose members are components of the multiprotein cytoplasmic dynein complex, which is involved in intracellular trafficking and chromosome segregation during mitosis. The protein plays a role in moving the spindle assembly checkpoint (SAC) from kinetochores to spindle poles. The protein may also mediate binding to other cargo molecules to facilitate intracellular vesicle trafficking. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit increased anxiety-related response, increased dendrite length, increased neuron migration, and decreased lysosome trafficking. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,261,287 probably null Het
4930523C07Rik A G 1: 160,044,802 noncoding transcript Het
5430419D17Rik A T 7: 131,247,465 D899V possibly damaging Het
Acot12 A G 13: 91,784,405 T507A possibly damaging Het
Agap2 T G 10: 127,091,650 C1113W probably damaging Het
Ap3s1-ps2 A T 8: 94,405,293 noncoding transcript Het
B3gnt3 T C 8: 71,693,769 R39G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Col6a1 T A 10: 76,718,405 K323* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dclre1c T C 2: 3,452,935 F285S possibly damaging Het
Dctn2 T G 10: 127,278,365 M360R probably benign Het
Dgka A T 10: 128,728,094 L462Q probably damaging Het
Drg2 A C 11: 60,468,146 K364T probably damaging Het
Fam189a2 T C 19: 23,979,435 T365A probably benign Het
Fer A T 17: 64,029,291 D554V possibly damaging Het
Fignl2 A G 15: 101,053,949 S151P possibly damaging Het
Gbgt1 A G 2: 28,498,408 Y35C probably damaging Het
Gm6526 T A 14: 43,748,845 I79K probably damaging Het
Gm884 T C 11: 103,618,314 probably benign Het
Gpr6 T G 10: 41,070,608 N326T probably damaging Het
Hcn4 C T 9: 58,843,895 T268M probably benign Het
Hist1h2bc C T 13: 23,684,503 T91M probably damaging Het
Hnf4g A G 3: 3,648,094 M243V possibly damaging Het
Homer1 A G 13: 93,402,069 E314G probably damaging Het
Hs6st1 T C 1: 36,104,027 Y348H probably damaging Het
Ifitm6 A T 7: 141,016,071 I103N probably damaging Het
Ipo5 T G 14: 120,943,893 C944G possibly damaging Het
Kcnb1 C A 2: 167,105,675 E418* probably null Het
Kcnk2 G A 1: 189,256,727 R207C probably damaging Het
Kctd8 T C 5: 69,341,162 E47G probably damaging Het
Klhdc2 C T 12: 69,307,597 probably benign Het
Mgat1 A G 11: 49,261,245 Y185C probably damaging Het
Mmp25 T A 17: 23,644,070 R122S probably damaging Het
Mrpl39 C A 16: 84,725,124 probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nek1 T C 8: 61,106,864 F1007S probably damaging Het
Neto1 T C 18: 86,404,856 M146T probably benign Het
Opn1sw G A 6: 29,379,424 R45* probably null Het
Osbpl5 A T 7: 143,709,815 C98* probably null Het
Pcdhb7 C T 18: 37,343,482 A557V probably benign Het
Pecam1 A G 11: 106,695,922 F155L possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pmfbp1 C A 8: 109,530,633 Q609K probably benign Het
Pnpo A T 11: 96,940,969 probably null Het
Ppp2cb G A 8: 33,617,049 R254Q probably benign Het
Qser1 A T 2: 104,789,421 S349T probably damaging Het
Rnf167 T A 11: 70,647,917 W17R probably damaging Het
Rpl21-ps4 A G 14: 11,227,879 noncoding transcript Het
Rxfp2 A T 5: 150,048,800 H158L probably benign Het
Ryr3 C T 2: 112,831,224 C1807Y probably damaging Het
Scaper T A 9: 55,838,180 E601D probably damaging Het
Secisbp2l A T 2: 125,752,915 C542S probably benign Het
Slc6a19 A G 13: 73,684,395 V393A possibly damaging Het
Stil A G 4: 115,009,377 N176S probably benign Het
Tap1 T A 17: 34,188,379 probably null Het
Tcl1b3 A T 12: 105,193,585 Q105L probably damaging Het
Tmem206 T A 1: 191,348,432 V283E probably damaging Het
Trappc10 G T 10: 78,217,188 A251D probably damaging Het
Trim43a G T 9: 88,582,153 C39F probably damaging Het
Ttn A T 2: 76,889,481 probably benign Het
Vmn2r110 A T 17: 20,583,689 L208* probably null Het
Vmn2r88 G T 14: 51,418,081 L583F probably damaging Het
Wasf1 C T 10: 40,936,582 H456Y unknown Het
Zfp120 A G 2: 150,118,185 I73T possibly damaging Het
Zfp990 T C 4: 145,536,728 C99R possibly damaging Het
Other mutations in Dync1li1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Dync1li1 APN 9 114720597 missense possibly damaging 0.89
R1510:Dync1li1 UTSW 9 114689210 missense possibly damaging 0.59
R1824:Dync1li1 UTSW 9 114709184 missense probably benign 0.01
R1955:Dync1li1 UTSW 9 114721746 missense probably damaging 0.99
R2000:Dync1li1 UTSW 9 114713563 missense probably benign 0.05
R2520:Dync1li1 UTSW 9 114689006 missense probably null 0.17
R2912:Dync1li1 UTSW 9 114715675 missense probably benign 0.31
R4422:Dync1li1 UTSW 9 114709309 missense probably damaging 1.00
R4646:Dync1li1 UTSW 9 114709169 missense probably damaging 0.96
R4693:Dync1li1 UTSW 9 114706098 missense probably damaging 0.99
R4817:Dync1li1 UTSW 9 114705094 missense probably benign 0.09
R5027:Dync1li1 UTSW 9 114713544 missense probably damaging 1.00
R5274:Dync1li1 UTSW 9 114715205 missense possibly damaging 0.84
R5363:Dync1li1 UTSW 9 114715229 missense probably damaging 0.99
R5902:Dync1li1 UTSW 9 114717861 critical splice acceptor site probably null
R6359:Dync1li1 UTSW 9 114713570 missense probably benign 0.29
R7235:Dync1li1 UTSW 9 114715163 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TAGTGCTGTTAAAAGAAACTGTGGC -3'
(R):5'- GGAATGGCTTTTATAGTCAGCTAAG -3'

Sequencing Primer
(F):5'- AAGAAACTGTGGCTTCTTTTGTTTTG -3'
(R):5'- GTCAGCTAAGATATCTCAATGGAAGC -3'
Posted On2015-07-07