Mutagenetix > Incidental Mutations

Incidental Mutation 'R4418:Col6a1'

326947

Institutional Source

Beutler Lab

Gene Symbol

Col6a1

Ensembl Gene

ENSMUSG00000001119

Gene Name

collagen, type VI, alpha 1

Synonyms

Col6a-1

MMRRC Submission

041139-MU

Accession Numbers

Ncbi RefSeq: NM_009933.4; MGI: 88459

Is this an essential gene?

Probably non essential (E-score: 0.179) question?

Stock #

R4418 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76708792-76726168 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 76718405 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 323 (K323*)

Ref Sequence

ENSEMBL: ENSMUSP00000001147 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001147]

Predicted Effect

probably null
Transcript: ENSMUST00000001147
AA Change: K323*

SMART Domains

Protein: ENSMUSP00000001147
Gene: ENSMUSG00000001119
AA Change: K323*

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
VWA	34	232	9.55e-29	SMART
Pfam:Collagen	252	312	5.6e-11	PFAM
Pfam:Collagen	292	367	2e-9	PFAM
Pfam:Collagen	345	423	3.6e-8	PFAM
Pfam:Collagen	448	515	1.1e-8	PFAM
Pfam:Collagen	499	563	1.9e-9	PFAM
low complexity region	571	590	N/A	INTRINSIC
VWA	612	798	8.57e-31	SMART
VWA	824	1005	2.6e-30	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137599

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

95% (72/76)

MGI Phenotype

Strain: 2153356
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The collagens are a superfamily of proteins that play a role in maintaining the integrity of various tissues. Collagens are extracellular matrix proteins and have a triple-helical domain as their common structural element. Collagen VI is a major structural component of microfibrils. The basic structural unit of collagen VI is a heterotrimer of the alpha1(VI), alpha2(VI), and alpha3(VI) chains. The alpha2(VI) and alpha3(VI) chains are encoded by the COL6A2 and COL6A3 genes, respectively. The protein encoded by this gene is the alpha 1 subunit of type VI collagen (alpha1(VI) chain). Mutations in the genes that code for the collagen VI subunits result in the autosomal dominant disorder, Bethlem myopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation display a myopathic disorder that resembles human Bethlem myopathy. Loss of contractile strength in affected muscles is associated with an unexpected latent mitochondrial dysfunction in myofibers, as well as spontaneous apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	C	18: 38,261,287		probably null	Het
4930523C07Rik	A	G	1: 160,044,802		noncoding transcript	Het
5430419D17Rik	A	T	7: 131,247,465	D899V	possibly damaging	Het
Acot12	A	G	13: 91,784,405	T507A	possibly damaging	Het
Agap2	T	G	10: 127,091,650	C1113W	probably damaging	Het
Ap3s1-ps2	A	T	8: 94,405,293		noncoding transcript	Het
B3gnt3	T	C	8: 71,693,769	R39G	probably benign	Het
Bahd1	G	A	2: 118,922,523	R757H	probably damaging	Het
Chad	C	T	11: 94,567,837	H271Y	possibly damaging	Het
Chil4	G	A	3: 106,203,727	P284S	possibly damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dclre1c	T	C	2: 3,452,935	F285S	possibly damaging	Het
Dctn2	T	G	10: 127,278,365	M360R	probably benign	Het
Dgka	A	T	10: 128,728,094	L462Q	probably damaging	Het
Drg2	A	C	11: 60,468,146	K364T	probably damaging	Het
Dync1li1	T	A	9: 114,706,170	S167R	probably damaging	Het
Fam189a2	T	C	19: 23,979,435	T365A	probably benign	Het
Fer	A	T	17: 64,029,291	D554V	possibly damaging	Het
Fignl2	A	G	15: 101,053,949	S151P	possibly damaging	Het
Gbgt1	A	G	2: 28,498,408	Y35C	probably damaging	Het
Gm6526	T	A	14: 43,748,845	I79K	probably damaging	Het
Gm884	T	C	11: 103,618,314		probably benign	Het
Gpr6	T	G	10: 41,070,608	N326T	probably damaging	Het
Hcn4	C	T	9: 58,843,895	T268M	probably benign	Het
Hist1h2bc	C	T	13: 23,684,503	T91M	probably damaging	Het
Hnf4g	A	G	3: 3,648,094	M243V	possibly damaging	Het
Homer1	A	G	13: 93,402,069	E314G	probably damaging	Het
Hs6st1	T	C	1: 36,104,027	Y348H	probably damaging	Het
Ifitm6	A	T	7: 141,016,071	I103N	probably damaging	Het
Ipo5	T	G	14: 120,943,893	C944G	possibly damaging	Het
Kcnb1	C	A	2: 167,105,675	E418*	probably null	Het
Kcnk2	G	A	1: 189,256,727	R207C	probably damaging	Het
Kctd8	T	C	5: 69,341,162	E47G	probably damaging	Het
Klhdc2	C	T	12: 69,307,597		probably benign	Het
Mgat1	A	G	11: 49,261,245	Y185C	probably damaging	Het
Mmp25	T	A	17: 23,644,070	R122S	probably damaging	Het
Mrpl39	C	A	16: 84,725,124		probably null	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Nek1	T	C	8: 61,106,864	F1007S	probably damaging	Het
Neto1	T	C	18: 86,404,856	M146T	probably benign	Het
Opn1sw	G	A	6: 29,379,424	R45*	probably null	Het
Osbpl5	A	T	7: 143,709,815	C98*	probably null	Het
Pcdhb7	C	T	18: 37,343,482	A557V	probably benign	Het
Pecam1	A	G	11: 106,695,922	F155L	possibly damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Pmfbp1	C	A	8: 109,530,633	Q609K	probably benign	Het
Pnpo	A	T	11: 96,940,969		probably null	Het
Ppp2cb	G	A	8: 33,617,049	R254Q	probably benign	Het
Qser1	A	T	2: 104,789,421	S349T	probably damaging	Het
Rnf167	T	A	11: 70,647,917	W17R	probably damaging	Het
Rpl21-ps4	A	G	14: 11,227,879		noncoding transcript	Het
Rxfp2	A	T	5: 150,048,800	H158L	probably benign	Het
Ryr3	C	T	2: 112,831,224	C1807Y	probably damaging	Het
Scaper	T	A	9: 55,838,180	E601D	probably damaging	Het
Secisbp2l	A	T	2: 125,752,915	C542S	probably benign	Het
Slc6a19	A	G	13: 73,684,395	V393A	possibly damaging	Het
Stil	A	G	4: 115,009,377	N176S	probably benign	Het
Tap1	T	A	17: 34,188,379		probably null	Het
Tcl1b3	A	T	12: 105,193,585	Q105L	probably damaging	Het
Tmem206	T	A	1: 191,348,432	V283E	probably damaging	Het
Trappc10	G	T	10: 78,217,188	A251D	probably damaging	Het
Trim43a	G	T	9: 88,582,153	C39F	probably damaging	Het
Ttn	A	T	2: 76,889,481		probably benign	Het
Vmn2r110	A	T	17: 20,583,689	L208*	probably null	Het
Vmn2r88	G	T	14: 51,418,081	L583F	probably damaging	Het
Wasf1	C	T	10: 40,936,582	H456Y	unknown	Het
Zfp120	A	G	2: 150,118,185	I73T	possibly damaging	Het
Zfp990	T	C	4: 145,536,728	C99R	possibly damaging	Het

Other mutations in Col6a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Col6a1	APN	10	76710979	missense	unknown
IGL01943:Col6a1	APN	10	76719123	critical splice donor site	probably null
IGL02178:Col6a1	APN	10	76711075	missense	unknown
IGL02928:Col6a1	APN	10	76709666	missense	possibly damaging	0.93
IGL03162:Col6a1	APN	10	76718051	splice site	probably benign
P0005:Col6a1	UTSW	10	76717329	splice site	probably benign
R0398:Col6a1	UTSW	10	76710118	missense	unknown
R0631:Col6a1	UTSW	10	76709735	missense	probably benign	0.03
R0698:Col6a1	UTSW	10	76716280	missense	unknown
R0699:Col6a1	UTSW	10	76716280	missense	unknown
R0848:Col6a1	UTSW	10	76713624	critical splice donor site	probably null
R1053:Col6a1	UTSW	10	76720966	missense	probably damaging	0.99
R1235:Col6a1	UTSW	10	76712324	missense	unknown
R1480:Col6a1	UTSW	10	76709918	missense	unknown
R1854:Col6a1	UTSW	10	76721949	missense	probably damaging	1.00
R1995:Col6a1	UTSW	10	76721956	missense	probably damaging	1.00
R2082:Col6a1	UTSW	10	76709596	missense	probably damaging	0.98
R2122:Col6a1	UTSW	10	76721498	missense	probably benign	0.10
R2411:Col6a1	UTSW	10	76711088	missense	unknown
R3236:Col6a1	UTSW	10	76711320	missense	unknown
R3417:Col6a1	UTSW	10	76712369	missense	unknown
R3832:Col6a1	UTSW	10	76711117	missense	unknown
R3843:Col6a1	UTSW	10	76711341	missense	unknown
R3903:Col6a1	UTSW	10	76711341	missense	unknown
R3904:Col6a1	UTSW	10	76711341	missense	unknown
R4409:Col6a1	UTSW	10	76721500	missense	probably benign	0.17
R4568:Col6a1	UTSW	10	76719197	intron	probably benign
R4579:Col6a1	UTSW	10	76711357	missense	unknown
R4661:Col6a1	UTSW	10	76714672	missense	unknown
R4945:Col6a1	UTSW	10	76712272	missense	unknown
R4958:Col6a1	UTSW	10	76723505	missense	probably damaging	1.00
R5101:Col6a1	UTSW	10	76709906	missense	unknown
R5440:Col6a1	UTSW	10	76723454	missense	probably damaging	1.00
R5924:Col6a1	UTSW	10	76718371	critical splice donor site	probably null
R6030:Col6a1	UTSW	10	76709866	missense	unknown
R6030:Col6a1	UTSW	10	76709866	missense	unknown
R6366:Col6a1	UTSW	10	76710970	missense	unknown
R6435:Col6a1	UTSW	10	76711123	missense	unknown
R6718:Col6a1	UTSW	10	76725050	missense	probably damaging	1.00
R7014:Col6a1	UTSW	10	76721443	missense	probably damaging	1.00
R7117:Col6a1	UTSW	10	76725009	missense	probably damaging	1.00
R7153:Col6a1	UTSW	10	76710341	splice site	probably null
R7183:Col6a1	UTSW	10	76716259	critical splice donor site	probably null
R7244:Col6a1	UTSW	10	76717408	nonsense	probably null
R7625:Col6a1	UTSW	10	76713926	missense	unknown
R7741:Col6a1	UTSW	10	76709909	missense	unknown
R7774:Col6a1	UTSW	10	76709876	missense	unknown
R7834:Col6a1	UTSW	10	76709928	missense	unknown
R8145:Col6a1	UTSW	10	76723471	missense	possibly damaging	0.46
R8177:Col6a1	UTSW	10	76725029	missense	probably damaging	1.00
RF019:Col6a1	UTSW	10	76711615	missense	unknown
X0010:Col6a1	UTSW	10	76723538	missense	probably damaging	1.00
X0067:Col6a1	UTSW	10	76709975	missense	unknown
Z1088:Col6a1	UTSW	10	76709559	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTGAGATCAAGTGGCTCGC -3'
(R):5'- TCAGAACACAGACCCTGTTGTC -3'

Sequencing Primer
(F):5'- CTCGCTTGGGGTTTACTAGGACC -3'
(R):5'- AGAACACAGACCCTGTTGTCTTTTC -3'

Posted On

2015-07-07