Incidental Mutation 'R4419:D2hgdh'
ID326980
Institutional Source Beutler Lab
Gene Symbol D2hgdh
Ensembl Gene ENSMUSG00000073609
Gene NameD-2-hydroxyglutarate dehydrogenase
Synonyms
MMRRC Submission 041140-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R4419 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location93824909-93852348 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93829813 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 150 (V150E)
Ref Sequence ENSEMBL: ENSMUSP00000140506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097633] [ENSMUST00000112881] [ENSMUST00000187321] [ENSMUST00000188532] [ENSMUST00000189154]
Predicted Effect probably damaging
Transcript: ENSMUST00000097633
AA Change: V150E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095235
Gene: ENSMUSG00000073609
AA Change: V150E

DomainStartEndE-ValueType
Pfam:FAD_binding_4 114 253 2.7e-35 PFAM
Pfam:FAD-oxidase_C 289 530 7.3e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112881
AA Change: V172E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108502
Gene: ENSMUSG00000073609
AA Change: V172E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:FAD_binding_4 136 275 7e-36 PFAM
Pfam:FAD-oxidase_C 311 552 4.1e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149397
Predicted Effect unknown
Transcript: ENSMUST00000186783
AA Change: V6E
Predicted Effect probably benign
Transcript: ENSMUST00000187321
Predicted Effect probably benign
Transcript: ENSMUST00000188532
AA Change: V6E

PolyPhen 2 Score 0.340 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably damaging
Transcript: ENSMUST00000189154
AA Change: V150E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140506
Gene: ENSMUSG00000073609
AA Change: V150E

DomainStartEndE-ValueType
Pfam:FAD_binding_4 114 179 3.2e-10 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes D-2hydroxyglutarate dehydrogenase, a mitochondrial enzyme belonging to the FAD-binding oxidoreductase/transferase type 4 family. This enzyme, which is most active in liver and kidney but also active in heart and brain, converts D-2-hydroxyglutarate to 2-ketoglutarate. Mutations in this gene are present in D-2-hydroxyglutaric aciduria, a rare recessive neurometabolic disorder causing developmental delay, epilepsy, hypotonia, and dysmorphic features. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amdhd2 G A 17: 24,158,678 P126L probably benign Het
Arfip2 T C 7: 105,639,063 T44A probably damaging Het
B4galt1 A G 4: 40,853,537 V90A probably benign Het
Bad C A 19: 6,950,685 A115E probably benign Het
Bicc1 A G 10: 70,946,974 L521P possibly damaging Het
Caskin1 T C 17: 24,504,709 S824P probably damaging Het
Cblb T A 16: 52,047,258 D76E possibly damaging Het
Celsr3 G T 9: 108,843,244 A2572S possibly damaging Het
Csmd3 T C 15: 47,704,311 Q2152R probably damaging Het
Ddn C A 15: 98,805,611 W600L probably benign Het
Dicer1 A T 12: 104,705,114 Y966N probably damaging Het
Dsp T A 13: 38,195,132 I1352N probably damaging Het
Duox1 G A 2: 122,327,126 A578T probably benign Het
Dysf T C 6: 84,207,242 probably null Het
Elmo2 T C 2: 165,311,755 probably null Het
Heg1 A T 16: 33,727,435 E864V probably benign Het
Hoxb9 T C 11: 96,271,981 V147A probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Ky G A 9: 102,542,710 V639I probably damaging Het
Med16 G A 10: 79,898,382 A566V probably benign Het
Mettl17 G T 14: 51,887,272 G167C possibly damaging Het
Mgat4b T C 11: 50,232,986 F318L probably damaging Het
Mug2 C A 6: 122,079,630 A1178D probably damaging Het
Myo3b A G 2: 70,096,362 D51G probably damaging Het
Naip2 T C 13: 100,160,625 N968D probably benign Het
Nbea T C 3: 56,009,600 H820R probably damaging Het
Nqo1 C T 8: 107,392,117 probably null Het
Olfr1328 A T 4: 118,934,389 I153N possibly damaging Het
Olfr780 T C 10: 129,321,815 F64S possibly damaging Het
Olfr916 C T 9: 38,658,069 V108I probably benign Het
Ppargc1a T C 5: 51,494,702 D218G probably damaging Het
Rras A G 7: 45,020,579 D145G probably damaging Het
Scn3a C A 2: 65,466,960 G1452C probably damaging Het
Slc22a2 C A 17: 12,612,586 S421* probably null Het
Slc39a10 A G 1: 46,810,066 F797L probably benign Het
Spta1 T A 1: 174,247,424 Y2405* probably null Het
Ss18 A G 18: 14,633,605 Y359H unknown Het
St14 C T 9: 31,096,928 C537Y probably damaging Het
Tmem252 T A 19: 24,677,546 Y96N probably damaging Het
Trafd1 T C 5: 121,373,333 D474G probably benign Het
Trmt1l A G 1: 151,440,808 I20M probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn1r43 A G 6: 89,869,647 S286P probably benign Het
Other mutations in D2hgdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:D2hgdh APN 1 93829889 missense probably benign 0.06
IGL02506:D2hgdh APN 1 93829785 missense probably damaging 0.98
IGL02995:D2hgdh APN 1 93829836 missense probably damaging 1.00
PIT1430001:D2hgdh UTSW 1 93826279 unclassified probably benign
PIT4418001:D2hgdh UTSW 1 93838868 missense possibly damaging 0.90
R0069:D2hgdh UTSW 1 93835287 missense possibly damaging 0.93
R0080:D2hgdh UTSW 1 93826455 missense probably damaging 0.97
R0538:D2hgdh UTSW 1 93826377 missense probably damaging 0.97
R2267:D2hgdh UTSW 1 93835435 missense probably damaging 0.97
R2268:D2hgdh UTSW 1 93835435 missense probably damaging 0.97
R2269:D2hgdh UTSW 1 93835435 missense probably damaging 0.97
R5322:D2hgdh UTSW 1 93829898 critical splice donor site probably null
R6018:D2hgdh UTSW 1 93826460 missense probably benign 0.03
R6264:D2hgdh UTSW 1 93826455 missense probably damaging 0.97
R6750:D2hgdh UTSW 1 93826407 missense probably benign 0.01
R6814:D2hgdh UTSW 1 93835303 missense possibly damaging 0.94
R7058:D2hgdh UTSW 1 93835374 missense probably damaging 1.00
R7473:D2hgdh UTSW 1 93838078 missense probably damaging 0.96
R7683:D2hgdh UTSW 1 93838965 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGTAGTAGAAAGGCCTGG -3'
(R):5'- ACCAGAATGTCCCAGTCAGG -3'

Sequencing Primer
(F):5'- CCTGGAAAGGAGATCTGGTTTG -3'
(R):5'- CTAGCCTAACCACAGTCTTAGTG -3'
Posted On2015-07-07