Incidental Mutation 'R4419:Duox1'
ID 326984
Institutional Source Beutler Lab
Gene Symbol Duox1
Ensembl Gene ENSMUSG00000033268
Gene Name dual oxidase 1
Synonyms THOX1, LNOX1, 9930101G15Rik, NOXEF1
MMRRC Submission 041140-MU
Accession Numbers

Genbank: NM_001099297; MGI: 2139422

Essential gene? Non essential (E-score: 0.000) question?
Stock # R4419 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 122315672-122347972 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 122327126 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 578 (A578T)
Ref Sequence ENSEMBL: ENSMUSP00000097060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099461]
AlphaFold A2AQ92
Predicted Effect probably benign
Transcript: ENSMUST00000099461
AA Change: A578T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: A578T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:An_peroxidase 29 557 2.1e-134 PFAM
transmembrane domain 594 616 N/A INTRINSIC
EFh 819 847 1.82e-4 SMART
EFh 855 883 3.45e-5 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Ferric_reduct 1087 1236 5.3e-21 PFAM
Pfam:FAD_binding_8 1272 1374 8.5e-21 PFAM
Pfam:NAD_binding_6 1380 1534 3.5e-33 PFAM
Meta Mutation Damage Score 0.0602 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

 
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amdhd2 G A 17: 24,158,678 P126L probably benign Het
Arfip2 T C 7: 105,639,063 T44A probably damaging Het
B4galt1 A G 4: 40,853,537 V90A probably benign Het
Bad C A 19: 6,950,685 A115E probably benign Het
Bicc1 A G 10: 70,946,974 L521P possibly damaging Het
Caskin1 T C 17: 24,504,709 S824P probably damaging Het
Cblb T A 16: 52,047,258 D76E possibly damaging Het
Celsr3 G T 9: 108,843,244 A2572S possibly damaging Het
Csmd3 T C 15: 47,704,311 Q2152R probably damaging Het
D2hgdh T A 1: 93,829,813 V150E probably damaging Het
Ddn C A 15: 98,805,611 W600L probably benign Het
Dicer1 A T 12: 104,705,114 Y966N probably damaging Het
Dsp T A 13: 38,195,132 I1352N probably damaging Het
Dysf T C 6: 84,207,242 probably null Het
Elmo2 T C 2: 165,311,755 probably null Het
Heg1 A T 16: 33,727,435 E864V probably benign Het
Hoxb9 T C 11: 96,271,981 V147A probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Ky G A 9: 102,542,710 V639I probably damaging Het
Med16 G A 10: 79,898,382 A566V probably benign Het
Mettl17 G T 14: 51,887,272 G167C possibly damaging Het
Mgat4b T C 11: 50,232,986 F318L probably damaging Het
Mug2 C A 6: 122,079,630 A1178D probably damaging Het
Myo3b A G 2: 70,096,362 D51G probably damaging Het
Naip2 T C 13: 100,160,625 N968D probably benign Het
Nbea T C 3: 56,009,600 H820R probably damaging Het
Nqo1 C T 8: 107,392,117 probably null Het
Olfr1328 A T 4: 118,934,389 I153N possibly damaging Het
Olfr780 T C 10: 129,321,815 F64S possibly damaging Het
Olfr916 C T 9: 38,658,069 V108I probably benign Het
Ppargc1a T C 5: 51,494,702 D218G probably damaging Het
Rras A G 7: 45,020,579 D145G probably damaging Het
Scn3a C A 2: 65,466,960 G1452C probably damaging Het
Slc22a2 C A 17: 12,612,586 S421* probably null Het
Slc39a10 A G 1: 46,810,066 F797L probably benign Het
Spta1 T A 1: 174,247,424 Y2405* probably null Het
Ss18 A G 18: 14,633,605 Y359H unknown Het
St14 C T 9: 31,096,928 C537Y probably damaging Het
Tmem252 T A 19: 24,677,546 Y96N probably damaging Het
Trafd1 T C 5: 121,373,333 D474G probably benign Het
Trmt1l A G 1: 151,440,808 I20M probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn1r43 A G 6: 89,869,647 S286P probably benign Het
Other mutations in Duox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Duox1 APN 2 122333141 missense possibly damaging 0.55
IGL00956:Duox1 APN 2 122323306 missense probably benign 0.42
IGL01413:Duox1 APN 2 122320710 missense probably benign 0.03
IGL01444:Duox1 APN 2 122340090 missense probably damaging 0.98
IGL01633:Duox1 APN 2 122333798 missense probably benign 0.00
IGL01814:Duox1 APN 2 122346272 missense probably damaging 0.99
IGL01868:Duox1 APN 2 122338407 missense probably benign
IGL02096:Duox1 APN 2 122344174 missense probably damaging 0.99
IGL02126:Duox1 APN 2 122346336 missense probably benign 0.21
IGL02342:Duox1 APN 2 122347312 missense probably damaging 1.00
IGL02687:Duox1 APN 2 122336415 missense probably damaging 1.00
IGL02708:Duox1 APN 2 122326017 missense possibly damaging 0.81
IGL02935:Duox1 APN 2 122324519 missense possibly damaging 0.56
antiquity UTSW 2 122340201 missense probably damaging 1.00
Dejavous UTSW 2 122320864 missense probably damaging 1.00
R1706_Duox1_051 UTSW 2 122319472 missense probably benign 0.01
R5032_duox1_732 UTSW 2 122337317 missense probably benign
Vaguely UTSW 2 122326135 nonsense probably null
D4043:Duox1 UTSW 2 122344795 missense probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0241:Duox1 UTSW 2 122333397 splice site probably benign
R0479:Duox1 UTSW 2 122346380 missense probably damaging 1.00
R0834:Duox1 UTSW 2 122346501 missense probably damaging 1.00
R1105:Duox1 UTSW 2 122337702 missense probably damaging 0.97
R1205:Duox1 UTSW 2 122327925 nonsense probably null
R1281:Duox1 UTSW 2 122327088 missense probably damaging 1.00
R1302:Duox1 UTSW 2 122347279 missense probably benign 0.24
R1532:Duox1 UTSW 2 122344723 missense probably damaging 1.00
R1706:Duox1 UTSW 2 122319472 missense probably benign 0.01
R1719:Duox1 UTSW 2 122338644 missense possibly damaging 0.93
R1753:Duox1 UTSW 2 122333429 missense probably damaging 1.00
R1827:Duox1 UTSW 2 122347380 nonsense probably null
R1828:Duox1 UTSW 2 122347380 nonsense probably null
R1940:Duox1 UTSW 2 122325984 missense probably benign 0.06
R1944:Duox1 UTSW 2 122346520 missense probably damaging 0.99
R2069:Duox1 UTSW 2 122333062 missense probably benign
R2113:Duox1 UTSW 2 122337254 missense probably benign
R2202:Duox1 UTSW 2 122344713 missense probably benign 0.19
R2314:Duox1 UTSW 2 122333730 nonsense probably null
R2507:Duox1 UTSW 2 122333138 missense probably benign 0.34
R2508:Duox1 UTSW 2 122333138 missense probably benign 0.34
R3177:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R3277:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R4124:Duox1 UTSW 2 122337421 missense probably damaging 1.00
R4271:Duox1 UTSW 2 122324375 missense probably damaging 0.96
R4411:Duox1 UTSW 2 122337634 missense probably benign 0.30
R4420:Duox1 UTSW 2 122327126 missense probably benign
R4578:Duox1 UTSW 2 122333777 missense probably benign 0.15
R4628:Duox1 UTSW 2 122346252 missense probably damaging 1.00
R4665:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4666:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4730:Duox1 UTSW 2 122333831 missense probably damaging 1.00
R4767:Duox1 UTSW 2 122333441 missense possibly damaging 0.79
R4857:Duox1 UTSW 2 122315731 missense probably benign 0.05
R4904:Duox1 UTSW 2 122320864 missense probably damaging 1.00
R5032:Duox1 UTSW 2 122337317 missense probably benign
R5201:Duox1 UTSW 2 122327922 missense probably benign
R5474:Duox1 UTSW 2 122346625 missense probably benign 0.02
R5835:Duox1 UTSW 2 122327860 missense probably benign 0.00
R5939:Duox1 UTSW 2 122346351 missense probably damaging 1.00
R5941:Duox1 UTSW 2 122344156 missense probably damaging 0.97
R5943:Duox1 UTSW 2 122333435 missense probably benign 0.00
R5970:Duox1 UTSW 2 122340201 missense probably damaging 1.00
R6023:Duox1 UTSW 2 122337684 missense probably benign 0.19
R6050:Duox1 UTSW 2 122319475 missense probably benign 0.00
R6064:Duox1 UTSW 2 122320762 missense probably benign 0.00
R6093:Duox1 UTSW 2 122347274 missense probably benign 0.01
R6188:Duox1 UTSW 2 122319794 missense probably benign 0.00
R6246:Duox1 UTSW 2 122327174 missense probably damaging 1.00
R6259:Duox1 UTSW 2 122344783 missense probably benign 0.00
R6290:Duox1 UTSW 2 122333807 missense possibly damaging 0.92
R6300:Duox1 UTSW 2 122337700 missense probably damaging 0.99
R6341:Duox1 UTSW 2 122337721 missense probably damaging 0.98
R6498:Duox1 UTSW 2 122319607 missense probably damaging 1.00
R6883:Duox1 UTSW 2 122324584 splice site probably null
R7002:Duox1 UTSW 2 122319877 nonsense probably null
R7410:Duox1 UTSW 2 122346393 missense probably damaging 1.00
R7421:Duox1 UTSW 2 122323230 missense probably damaging 1.00
R7608:Duox1 UTSW 2 122326135 nonsense probably null
R7702:Duox1 UTSW 2 122329639 missense possibly damaging 0.86
R7766:Duox1 UTSW 2 122337301 missense probably benign
R7833:Duox1 UTSW 2 122324388 missense probably damaging 1.00
R7980:Duox1 UTSW 2 122347320 missense possibly damaging 0.71
R8275:Duox1 UTSW 2 122344768 missense probably benign 0.02
R8717:Duox1 UTSW 2 122337671 missense possibly damaging 0.88
R8992:Duox1 UTSW 2 122344705 missense probably damaging 1.00
R9196:Duox1 UTSW 2 122320208 missense probably benign 0.08
R9344:Duox1 UTSW 2 122337682 missense probably benign 0.14
R9397:Duox1 UTSW 2 122320302 missense possibly damaging 0.48
R9491:Duox1 UTSW 2 122326426 missense probably benign 0.01
R9510:Duox1 UTSW 2 122329542 missense possibly damaging 0.92
R9521:Duox1 UTSW 2 122328735 missense possibly damaging 0.81
R9562:Duox1 UTSW 2 122320722 missense probably damaging 1.00
R9565:Duox1 UTSW 2 122320722 missense probably damaging 1.00
R9569:Duox1 UTSW 2 122318490 missense probably benign
Z1176:Duox1 UTSW 2 122333038 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTTGCTGCAATGACAGGGG -3'
(R):5'- AGCCAGACACCTTTGCCTTC -3'

Sequencing Primer
(F):5'- CTTGCTGCAATGACAGGGGTAAAC -3'
(R):5'- CCAGAGAGACAGTACTCTACATTG -3'
Posted On 2015-07-07