Incidental Mutation 'R4419:Mug2'
ID326996
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Namemurinoglobulin 2
Synonyms
MMRRC Submission 041140-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4419 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location122006761-122085965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 122079630 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 1178 (A1178D)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
Predicted Effect probably damaging
Transcript: ENSMUST00000081777
AA Change: A1178D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: A1178D

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amdhd2 G A 17: 24,158,678 P126L probably benign Het
Arfip2 T C 7: 105,639,063 T44A probably damaging Het
B4galt1 A G 4: 40,853,537 V90A probably benign Het
Bad C A 19: 6,950,685 A115E probably benign Het
Bicc1 A G 10: 70,946,974 L521P possibly damaging Het
Caskin1 T C 17: 24,504,709 S824P probably damaging Het
Cblb T A 16: 52,047,258 D76E possibly damaging Het
Celsr3 G T 9: 108,843,244 A2572S possibly damaging Het
Csmd3 T C 15: 47,704,311 Q2152R probably damaging Het
D2hgdh T A 1: 93,829,813 V150E probably damaging Het
Ddn C A 15: 98,805,611 W600L probably benign Het
Dicer1 A T 12: 104,705,114 Y966N probably damaging Het
Dsp T A 13: 38,195,132 I1352N probably damaging Het
Duox1 G A 2: 122,327,126 A578T probably benign Het
Dysf T C 6: 84,207,242 probably null Het
Elmo2 T C 2: 165,311,755 probably null Het
Heg1 A T 16: 33,727,435 E864V probably benign Het
Hoxb9 T C 11: 96,271,981 V147A probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Ky G A 9: 102,542,710 V639I probably damaging Het
Med16 G A 10: 79,898,382 A566V probably benign Het
Mettl17 G T 14: 51,887,272 G167C possibly damaging Het
Mgat4b T C 11: 50,232,986 F318L probably damaging Het
Myo3b A G 2: 70,096,362 D51G probably damaging Het
Naip2 T C 13: 100,160,625 N968D probably benign Het
Nbea T C 3: 56,009,600 H820R probably damaging Het
Nqo1 C T 8: 107,392,117 probably null Het
Olfr1328 A T 4: 118,934,389 I153N possibly damaging Het
Olfr780 T C 10: 129,321,815 F64S possibly damaging Het
Olfr916 C T 9: 38,658,069 V108I probably benign Het
Ppargc1a T C 5: 51,494,702 D218G probably damaging Het
Rras A G 7: 45,020,579 D145G probably damaging Het
Scn3a C A 2: 65,466,960 G1452C probably damaging Het
Slc22a2 C A 17: 12,612,586 S421* probably null Het
Slc39a10 A G 1: 46,810,066 F797L probably benign Het
Spta1 T A 1: 174,247,424 Y2405* probably null Het
Ss18 A G 18: 14,633,605 Y359H unknown Het
St14 C T 9: 31,096,928 C537Y probably damaging Het
Tmem252 T A 19: 24,677,546 Y96N probably damaging Het
Trafd1 T C 5: 121,373,333 D474G probably benign Het
Trmt1l A G 1: 151,440,808 I20M probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn1r43 A G 6: 89,869,647 S286P probably benign Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122047487 missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122040654 missense probably damaging 0.99
IGL01314:Mug2 APN 6 122081279 missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122049628 splice site probably benign
IGL01477:Mug2 APN 6 122081684 splice site probably benign
IGL01926:Mug2 APN 6 122036104 splice site probably benign
IGL02019:Mug2 APN 6 122047435 missense probably benign 0.02
IGL02305:Mug2 APN 6 122036056 missense probably benign
IGL02310:Mug2 APN 6 122059123 splice site probably benign
IGL02484:Mug2 APN 6 122072753 missense probably damaging 1.00
IGL02516:Mug2 APN 6 122070843 missense probably damaging 1.00
IGL02531:Mug2 APN 6 122072771 missense probably damaging 1.00
IGL02666:Mug2 APN 6 122081326 missense probably damaging 1.00
IGL02936:Mug2 APN 6 122081387 critical splice donor site probably null
R0114:Mug2 UTSW 6 122040648 missense probably damaging 1.00
R0119:Mug2 UTSW 6 122036063 missense probably benign 0.00
R0123:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122071011 splice site probably benign
R0225:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122081599 missense probably damaging 1.00
R0763:Mug2 UTSW 6 122075294 missense probably benign
R0959:Mug2 UTSW 6 122085495 missense probably benign 0.33
R1104:Mug2 UTSW 6 122059055 missense probably benign
R1239:Mug2 UTSW 6 122081678 splice site probably benign
R1318:Mug2 UTSW 6 122077402 missense probably damaging 1.00
R1460:Mug2 UTSW 6 122040533 splice site probably benign
R1706:Mug2 UTSW 6 122036232 splice site probably benign
R1761:Mug2 UTSW 6 122074705 missense probably benign 0.20
R1901:Mug2 UTSW 6 122071842 missense probably benign 0.02
R1913:Mug2 UTSW 6 122070870 missense probably damaging 1.00
R1943:Mug2 UTSW 6 122079639 missense probably benign
R2054:Mug2 UTSW 6 122077492 missense probably damaging 1.00
R2060:Mug2 UTSW 6 122079612 missense probably benign
R2420:Mug2 UTSW 6 122083460 missense probably damaging 1.00
R2432:Mug2 UTSW 6 122084376 missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122074724 splice site probably null
R2918:Mug2 UTSW 6 122074724 splice site probably null
R3423:Mug2 UTSW 6 122047506 splice site probably benign
R3834:Mug2 UTSW 6 122049787 critical splice donor site probably null
R3902:Mug2 UTSW 6 122075567 missense probably damaging 1.00
R3941:Mug2 UTSW 6 122063563 missense probably benign
R4227:Mug2 UTSW 6 122040732 missense probably benign 0.10
R4284:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4287:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4377:Mug2 UTSW 6 122071007 critical splice donor site probably null
R4498:Mug2 UTSW 6 122082752 missense probably damaging 0.99
R4566:Mug2 UTSW 6 122079638 missense probably benign 0.00
R4690:Mug2 UTSW 6 122036296 missense probably benign
R4732:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4733:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4741:Mug2 UTSW 6 122079613 missense probably benign
R4888:Mug2 UTSW 6 122081195 missense probably damaging 1.00
R5199:Mug2 UTSW 6 122040660 missense probably benign
R5347:Mug2 UTSW 6 122081592 missense probably damaging 1.00
R5457:Mug2 UTSW 6 122049729 nonsense probably null
R5495:Mug2 UTSW 6 122079650 missense probably damaging 0.96
R5509:Mug2 UTSW 6 122084381 missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122083500 missense probably null 0.98
R6180:Mug2 UTSW 6 122079606 missense probably benign 0.01
R6184:Mug2 UTSW 6 122037046 missense probably benign
R6199:Mug2 UTSW 6 122047439 missense probably benign 0.05
R6262:Mug2 UTSW 6 122075255 missense probably damaging 1.00
R6416:Mug2 UTSW 6 122082754 missense probably damaging 1.00
R6548:Mug2 UTSW 6 122047442 missense probably damaging 1.00
R6703:Mug2 UTSW 6 122078694 missense probably benign 0.25
R7106:Mug2 UTSW 6 122082721 missense probably damaging 1.00
R7131:Mug2 UTSW 6 122075247 missense probably damaging 1.00
R7372:Mug2 UTSW 6 122083466 missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122047487 missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122040570 missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122079726 missense probably benign 0.00
R7581:Mug2 UTSW 6 122063711 missense probably damaging 1.00
R7582:Mug2 UTSW 6 122079644 missense probably damaging 0.99
R7672:Mug2 UTSW 6 122040719 missense probably benign 0.37
R7713:Mug2 UTSW 6 122078795 missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122081358 missense probably damaging 1.00
R7834:Mug2 UTSW 6 122036282 missense probably benign
R7850:Mug2 UTSW 6 122075211 missense probably damaging 1.00
R8029:Mug2 UTSW 6 122081545 critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122075608 missense probably benign 0.01
R8335:Mug2 UTSW 6 122040584 missense probably benign
R8348:Mug2 UTSW 6 122072233 nonsense probably null
R8557:Mug2 UTSW 6 122063701 missense probably damaging 0.99
R8798:Mug2 UTSW 6 122081610 missense probably damaging 1.00
R8823:Mug2 UTSW 6 122063689 missense possibly damaging 0.89
Z1177:Mug2 UTSW 6 122037121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAATCGATTGCACTCACTGG -3'
(R):5'- AAAACCACCAACCTGTGTGG -3'

Sequencing Primer
(F):5'- GCACTCACTGGAAATTTTTACTGAG -3'
(R):5'- CACCAACCTGTGTGGAGGAG -3'
Posted On2015-07-07