Incidental Mutation 'R4419:Rras'
ID326997
Institutional Source Beutler Lab
Gene Symbol Rras
Ensembl Gene ENSMUSG00000038387
Gene Namerelated RAS viral (r-ras) oncogene
Synonyms
MMRRC Submission 041140-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4419 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45017961-45021647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45020579 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 145 (D145G)
Ref Sequence ENSEMBL: ENSMUSP00000042150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044111] [ENSMUST00000085383] [ENSMUST00000210895] [ENSMUST00000211680]
Predicted Effect probably damaging
Transcript: ENSMUST00000044111
AA Change: D145G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042150
Gene: ENSMUSG00000038387
AA Change: D145G

DomainStartEndE-ValueType
RAS 27 193 2.25e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085383
SMART Domains Protein: ENSMUSP00000082501
Gene: ENSMUSG00000038406

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 185 224 N/A INTRINSIC
coiled coil region 269 295 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 382 396 N/A INTRINSIC
low complexity region 411 435 N/A INTRINSIC
low complexity region 488 511 N/A INTRINSIC
low complexity region 534 618 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
low complexity region 703 726 N/A INTRINSIC
low complexity region 730 739 N/A INTRINSIC
low complexity region 752 775 N/A INTRINSIC
Blast:IG_like 776 833 6e-6 BLAST
low complexity region 843 873 N/A INTRINSIC
low complexity region 876 888 N/A INTRINSIC
low complexity region 917 937 N/A INTRINSIC
coiled coil region 963 983 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
low complexity region 1098 1128 N/A INTRINSIC
low complexity region 1136 1146 N/A INTRINSIC
Blast:IG_like 1151 1194 2e-16 BLAST
low complexity region 1225 1256 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210056
Predicted Effect probably benign
Transcript: ENSMUST00000210397
Predicted Effect probably benign
Transcript: ENSMUST00000210895
Predicted Effect probably benign
Transcript: ENSMUST00000211680
Meta Mutation Damage Score 0.9682 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a small GTPase involved in diverse processes including angiogenesis, vascular homeostasis and regeneration, cell adhesion, and neuronal axon guidance. Mutations in this gene are found in many invasive cancers. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit enhanced neointimal thickening in response to arterial injury, increased angiogenesis in matrigel plugs and aortic ring cultures, and increased neovascularization of tumor implants, and decreased B-cell and increased T-cell population percentages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amdhd2 G A 17: 24,158,678 P126L probably benign Het
Arfip2 T C 7: 105,639,063 T44A probably damaging Het
B4galt1 A G 4: 40,853,537 V90A probably benign Het
Bad C A 19: 6,950,685 A115E probably benign Het
Bicc1 A G 10: 70,946,974 L521P possibly damaging Het
Caskin1 T C 17: 24,504,709 S824P probably damaging Het
Cblb T A 16: 52,047,258 D76E possibly damaging Het
Celsr3 G T 9: 108,843,244 A2572S possibly damaging Het
Csmd3 T C 15: 47,704,311 Q2152R probably damaging Het
D2hgdh T A 1: 93,829,813 V150E probably damaging Het
Ddn C A 15: 98,805,611 W600L probably benign Het
Dicer1 A T 12: 104,705,114 Y966N probably damaging Het
Dsp T A 13: 38,195,132 I1352N probably damaging Het
Duox1 G A 2: 122,327,126 A578T probably benign Het
Dysf T C 6: 84,207,242 probably null Het
Elmo2 T C 2: 165,311,755 probably null Het
Heg1 A T 16: 33,727,435 E864V probably benign Het
Hoxb9 T C 11: 96,271,981 V147A probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Ky G A 9: 102,542,710 V639I probably damaging Het
Med16 G A 10: 79,898,382 A566V probably benign Het
Mettl17 G T 14: 51,887,272 G167C possibly damaging Het
Mgat4b T C 11: 50,232,986 F318L probably damaging Het
Mug2 C A 6: 122,079,630 A1178D probably damaging Het
Myo3b A G 2: 70,096,362 D51G probably damaging Het
Naip2 T C 13: 100,160,625 N968D probably benign Het
Nbea T C 3: 56,009,600 H820R probably damaging Het
Nqo1 C T 8: 107,392,117 probably null Het
Olfr1328 A T 4: 118,934,389 I153N possibly damaging Het
Olfr780 T C 10: 129,321,815 F64S possibly damaging Het
Olfr916 C T 9: 38,658,069 V108I probably benign Het
Ppargc1a T C 5: 51,494,702 D218G probably damaging Het
Scn3a C A 2: 65,466,960 G1452C probably damaging Het
Slc22a2 C A 17: 12,612,586 S421* probably null Het
Slc39a10 A G 1: 46,810,066 F797L probably benign Het
Spta1 T A 1: 174,247,424 Y2405* probably null Het
Ss18 A G 18: 14,633,605 Y359H unknown Het
St14 C T 9: 31,096,928 C537Y probably damaging Het
Tmem252 T A 19: 24,677,546 Y96N probably damaging Het
Trafd1 T C 5: 121,373,333 D474G probably benign Het
Trmt1l A G 1: 151,440,808 I20M probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn1r43 A G 6: 89,869,647 S286P probably benign Het
Other mutations in Rras
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rras APN 7 45021285 missense possibly damaging 0.89
R0553:Rras UTSW 7 45020556 missense probably benign 0.00
R1297:Rras UTSW 7 45020579 missense probably damaging 1.00
R2495:Rras UTSW 7 45018064 missense probably damaging 1.00
R5833:Rras UTSW 7 45021291 missense possibly damaging 0.72
R6042:Rras UTSW 7 45020396 missense probably damaging 0.97
R6291:Rras UTSW 7 45018171 splice site probably null
R7542:Rras UTSW 7 45020342 missense probably damaging 1.00
R7782:Rras UTSW 7 45021105 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TTGCCATTAACGACAGGCAG -3'
(R):5'- CTTGTTCAGGACAGGGGAAC -3'

Sequencing Primer
(F):5'- CCATTAACGACAGGCAGAGGTG -3'
(R):5'- TTAGAATCCCTCAGTGATGGCCAG -3'
Posted On2015-07-07