Incidental Mutation 'R4419:Ky'
ID327004
Institutional Source Beutler Lab
Gene Symbol Ky
Ensembl Gene ENSMUSG00000035606
Gene Namekyphoscoliosis peptidase
SynonymsD9Mgc44e
MMRRC Submission 041140-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R4419 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location102505750-102546239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102542710 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 639 (V639I)
Ref Sequence ENSEMBL: ENSMUSP00000036032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039390]
Predicted Effect probably damaging
Transcript: ENSMUST00000039390
AA Change: V639I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036032
Gene: ENSMUSG00000035606
AA Change: V639I

DomainStartEndE-ValueType
TGc 217 285 1.9e-14 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a spontaneous mutation exhibit severe degenerative myopathy involving postural muscles, resulting in thoraco-lumbar kyphoscoliosis with degenerative changes in intervertebral discs. Body weight is reduced and breathing is irregular. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amdhd2 G A 17: 24,158,678 P126L probably benign Het
Arfip2 T C 7: 105,639,063 T44A probably damaging Het
B4galt1 A G 4: 40,853,537 V90A probably benign Het
Bad C A 19: 6,950,685 A115E probably benign Het
Bicc1 A G 10: 70,946,974 L521P possibly damaging Het
Caskin1 T C 17: 24,504,709 S824P probably damaging Het
Cblb T A 16: 52,047,258 D76E possibly damaging Het
Celsr3 G T 9: 108,843,244 A2572S possibly damaging Het
Csmd3 T C 15: 47,704,311 Q2152R probably damaging Het
D2hgdh T A 1: 93,829,813 V150E probably damaging Het
Ddn C A 15: 98,805,611 W600L probably benign Het
Dicer1 A T 12: 104,705,114 Y966N probably damaging Het
Dsp T A 13: 38,195,132 I1352N probably damaging Het
Duox1 G A 2: 122,327,126 A578T probably benign Het
Dysf T C 6: 84,207,242 probably null Het
Elmo2 T C 2: 165,311,755 probably null Het
Heg1 A T 16: 33,727,435 E864V probably benign Het
Hoxb9 T C 11: 96,271,981 V147A probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Med16 G A 10: 79,898,382 A566V probably benign Het
Mettl17 G T 14: 51,887,272 G167C possibly damaging Het
Mgat4b T C 11: 50,232,986 F318L probably damaging Het
Mug2 C A 6: 122,079,630 A1178D probably damaging Het
Myo3b A G 2: 70,096,362 D51G probably damaging Het
Naip2 T C 13: 100,160,625 N968D probably benign Het
Nbea T C 3: 56,009,600 H820R probably damaging Het
Nqo1 C T 8: 107,392,117 probably null Het
Olfr1328 A T 4: 118,934,389 I153N possibly damaging Het
Olfr780 T C 10: 129,321,815 F64S possibly damaging Het
Olfr916 C T 9: 38,658,069 V108I probably benign Het
Ppargc1a T C 5: 51,494,702 D218G probably damaging Het
Rras A G 7: 45,020,579 D145G probably damaging Het
Scn3a C A 2: 65,466,960 G1452C probably damaging Het
Slc22a2 C A 17: 12,612,586 S421* probably null Het
Slc39a10 A G 1: 46,810,066 F797L probably benign Het
Spta1 T A 1: 174,247,424 Y2405* probably null Het
Ss18 A G 18: 14,633,605 Y359H unknown Het
St14 C T 9: 31,096,928 C537Y probably damaging Het
Tmem252 T A 19: 24,677,546 Y96N probably damaging Het
Trafd1 T C 5: 121,373,333 D474G probably benign Het
Trmt1l A G 1: 151,440,808 I20M probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn1r43 A G 6: 89,869,647 S286P probably benign Het
Other mutations in Ky
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01515:Ky APN 9 102542105 missense probably benign
IGL02197:Ky APN 9 102537786 missense possibly damaging 0.63
PIT4802001:Ky UTSW 9 102537773 missense probably benign 0.00
R0384:Ky UTSW 9 102542090 missense probably benign 0.05
R0620:Ky UTSW 9 102537621 missense probably benign 0.04
R1099:Ky UTSW 9 102537724 missense probably damaging 1.00
R1754:Ky UTSW 9 102541927 missense possibly damaging 0.54
R2075:Ky UTSW 9 102542746 missense probably damaging 0.98
R2322:Ky UTSW 9 102537791 critical splice donor site probably null
R2415:Ky UTSW 9 102541891 missense probably damaging 1.00
R3950:Ky UTSW 9 102542428 nonsense probably null
R4786:Ky UTSW 9 102541987 missense probably benign 0.02
R5261:Ky UTSW 9 102537599 critical splice acceptor site probably null
R5529:Ky UTSW 9 102542075 missense probably benign 0.10
R6857:Ky UTSW 9 102542432 missense probably damaging 1.00
R6931:Ky UTSW 9 102537627 missense probably damaging 1.00
R7205:Ky UTSW 9 102542292 missense probably damaging 1.00
R7211:Ky UTSW 9 102509150 missense probably benign 0.08
R7570:Ky UTSW 9 102542329 missense probably benign 0.00
R7642:Ky UTSW 9 102542270 missense probably benign 0.32
R7644:Ky UTSW 9 102537773 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCTGAGAGCTTTGGCAAC -3'
(R):5'- AGAGGCCTAGAAGTGGTTTCATG -3'

Sequencing Primer
(F):5'- GGACAATGAACTGCTAGAGCCTCTC -3'
(R):5'- CCTAGAAGTGGTTTCATGCAGATTAG -3'
Posted On2015-07-07