Incidental Mutation 'R0016:Cdh16'
ID32701
Institutional Source Beutler Lab
Gene Symbol Cdh16
Ensembl Gene ENSMUSG00000031881
Gene Namecadherin 16
SynonymsKSP-cadherin
MMRRC Submission 038311-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R0016 (G1)
Quality Score225
Status Validated (trace)
Chromosome8
Chromosomal Location104601911-104624396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104617632 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 92 (T92S)
Ref Sequence ENSEMBL: ENSMUSP00000148701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163783] [ENSMUST00000211849] [ENSMUST00000211903] [ENSMUST00000212045] [ENSMUST00000212324] [ENSMUST00000212420] [ENSMUST00000212447] [ENSMUST00000212662] [ENSMUST00000212748] [ENSMUST00000212882] [ENSMUST00000213033]
Predicted Effect probably benign
Transcript: ENSMUST00000163783
AA Change: T567S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000129663
Gene: ENSMUSG00000031881
AA Change: T567S

DomainStartEndE-ValueType
CA 47 126 2.42e-9 SMART
CA 150 243 3.93e-9 SMART
CA 260 336 5.52e-13 SMART
CA 360 449 1.33e-15 SMART
CA 474 563 3.35e-1 SMART
CA 585 663 7.88e-1 SMART
transmembrane domain 788 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211849
Predicted Effect probably benign
Transcript: ENSMUST00000211889
Predicted Effect probably benign
Transcript: ENSMUST00000211903
AA Change: T597S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000212045
Predicted Effect probably benign
Transcript: ENSMUST00000212318
Predicted Effect probably benign
Transcript: ENSMUST00000212324
Predicted Effect probably benign
Transcript: ENSMUST00000212420
AA Change: T138S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000212447
Predicted Effect probably benign
Transcript: ENSMUST00000212662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212689
Predicted Effect probably benign
Transcript: ENSMUST00000212748
Predicted Effect probably benign
Transcript: ENSMUST00000212882
AA Change: T597S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000213033
AA Change: T92S

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0707 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. Mapped to a previously identified cluster of cadherin genes on chromosome 16q22.1, the gene localizes with superfamily members CDH1, CDH3, CDH5, CDH8 and CDH11. The protein consists of an extracellular domain containing 6 cadherin domains, a transmembrane region and a truncated cytoplasmic domain but lacks the prosequence and tripeptide HAV adhesion recognition sequence typical of most classical cadherins. Expression is exclusively in kidney, where the protein functions as the principal mediator of homotypic cellular recognition, playing a role in the morphogenic direction of tissue development. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,294,800 V1181G probably benign Het
Adamts12 A T 15: 11,217,829 I291F probably damaging Het
Aspm G C 1: 139,479,544 Q2056H probably benign Het
BC067074 T C 13: 113,366,105 Y115H probably damaging Het
C7 A T 15: 5,046,924 V122E probably benign Het
Casp12 A T 9: 5,352,844 Q152L probably null Het
Chrd G C 16: 20,734,308 V162L possibly damaging Het
Cpne8 A G 15: 90,501,405 probably benign Het
Cyp2j7 T A 4: 96,202,147 I347F probably damaging Het
Cyp4a10 A T 4: 115,521,107 Q130L probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Dgkd T C 1: 87,917,952 S294P probably benign Het
Dnah8 A G 17: 30,663,316 I621V probably benign Het
Dync2h1 A G 9: 7,144,346 probably benign Het
Echdc1 A T 10: 29,322,421 probably benign Het
Elovl3 T A 19: 46,132,158 F30Y probably damaging Het
Fa2h T C 8: 111,393,514 Y80C probably damaging Het
Fam208b A C 13: 3,585,170 probably null Het
Fgd3 C T 13: 49,296,609 D55N probably benign Het
Fhod1 T C 8: 105,331,655 E823G possibly damaging Het
Gapvd1 A G 2: 34,699,913 probably benign Het
Gm17067 A T 7: 42,708,622 I152K probably benign Het
Gm1966 G A 7: 106,603,246 L264F probably benign Het
Gm9833 A T 3: 10,089,319 M383L possibly damaging Het
Kif27 A G 13: 58,354,714 V50A probably damaging Het
Kpna2 T C 11: 106,991,086 T305A probably benign Het
Krtap22-2 A G 16: 89,010,519 probably benign Het
Lrp2bp T A 8: 46,012,031 F62L probably damaging Het
Marf1 G A 16: 14,152,265 H197Y probably damaging Het
Mob3b A G 4: 35,083,947 F81L probably benign Het
Mon2 C T 10: 123,035,546 V389M probably damaging Het
Myh8 A G 11: 67,298,525 K1176E probably damaging Het
Naf1 T C 8: 66,889,055 probably benign Het
Nckap1l A G 15: 103,475,636 T554A probably benign Het
Oog3 A G 4: 144,158,071 Y432H probably damaging Het
Paxbp1 A T 16: 91,036,036 probably benign Het
Phf20 A T 2: 156,267,194 K154* probably null Het
Plekhj1 T C 10: 80,796,416 D74G possibly damaging Het
Plpp4 T C 7: 129,323,424 C128R probably damaging Het
Rcan3 A T 4: 135,418,378 probably null Het
Sh3rf1 T A 8: 61,374,138 M642K probably benign Het
Slc7a1 A G 5: 148,334,583 V522A probably benign Het
Sorbs1 A G 19: 40,314,738 probably benign Het
Spry2 C T 14: 105,893,297 V152M probably benign Het
Srgap2 A G 1: 131,349,462 M349T possibly damaging Het
Stag3 A G 5: 138,291,381 H271R possibly damaging Het
Stat4 T C 1: 52,068,780 V136A probably benign Het
Stc2 A T 11: 31,360,177 D286E probably benign Het
Stk31 T C 6: 49,437,377 Y482H probably damaging Het
Ticrr C T 7: 79,693,792 P1135L probably benign Het
Tmem55b C T 14: 50,928,894 R213Q probably damaging Het
Trim27 A T 13: 21,191,229 E310V probably benign Het
Uvrag T C 7: 98,991,981 K284R probably benign Het
Vmn1r78 A C 7: 12,153,352 S297R probably benign Het
Xylt2 A G 11: 94,669,640 S270P probably damaging Het
Zfhx3 T C 8: 108,950,178 M2620T probably benign Het
Zkscan2 C A 7: 123,499,996 probably benign Het
Zwint T C 10: 72,657,198 probably benign Het
Other mutations in Cdh16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Cdh16 APN 8 104623413 missense probably benign 0.00
IGL01406:Cdh16 APN 8 104618412 missense possibly damaging 0.93
IGL01477:Cdh16 APN 8 104618508 missense probably damaging 0.97
IGL01478:Cdh16 APN 8 104614488 splice site probably benign
IGL01783:Cdh16 APN 8 104617856 missense probably damaging 1.00
IGL01951:Cdh16 APN 8 104617691 missense probably damaging 0.99
IGL02390:Cdh16 APN 8 104621974 missense probably damaging 1.00
IGL02646:Cdh16 APN 8 104622105 critical splice acceptor site probably null
IGL02938:Cdh16 APN 8 104616929 intron probably benign
IGL02961:Cdh16 APN 8 104615205 missense probably damaging 1.00
IGL03378:Cdh16 APN 8 104619285 missense probably benign 0.09
PIT1430001:Cdh16 UTSW 8 104617639 missense probably benign 0.05
R1233:Cdh16 UTSW 8 104618482 missense possibly damaging 0.89
R1470:Cdh16 UTSW 8 104618371 missense probably benign 0.04
R1470:Cdh16 UTSW 8 104618371 missense probably benign 0.04
R1490:Cdh16 UTSW 8 104622070 missense probably damaging 1.00
R1752:Cdh16 UTSW 8 104619873 critical splice donor site probably null
R1892:Cdh16 UTSW 8 104617999 missense possibly damaging 0.69
R1913:Cdh16 UTSW 8 104616468 missense probably benign 0.11
R1933:Cdh16 UTSW 8 104617963 missense possibly damaging 0.71
R1934:Cdh16 UTSW 8 104617963 missense possibly damaging 0.71
R2029:Cdh16 UTSW 8 104617802 missense probably damaging 1.00
R2057:Cdh16 UTSW 8 104621965 nonsense probably null
R2337:Cdh16 UTSW 8 104622270 missense probably benign 0.09
R3848:Cdh16 UTSW 8 104617841 missense possibly damaging 0.64
R3850:Cdh16 UTSW 8 104617841 missense possibly damaging 0.64
R3892:Cdh16 UTSW 8 104616327 missense probably damaging 1.00
R4167:Cdh16 UTSW 8 104617730 missense probably benign 0.02
R4577:Cdh16 UTSW 8 104618559 missense probably damaging 1.00
R4657:Cdh16 UTSW 8 104615226 unclassified probably null
R4726:Cdh16 UTSW 8 104616032 missense probably damaging 0.97
R4843:Cdh16 UTSW 8 104621540 missense probably damaging 1.00
R4878:Cdh16 UTSW 8 104618064 missense probably damaging 1.00
R5013:Cdh16 UTSW 8 104617028 missense probably damaging 1.00
R5642:Cdh16 UTSW 8 104618045 missense probably damaging 0.98
R6134:Cdh16 UTSW 8 104616065 missense probably benign 0.15
R6311:Cdh16 UTSW 8 104614433 missense probably benign 0.40
R6352:Cdh16 UTSW 8 104616992 missense probably damaging 0.99
R6382:Cdh16 UTSW 8 104621543 missense possibly damaging 0.78
R6713:Cdh16 UTSW 8 104619985 nonsense probably null
R6732:Cdh16 UTSW 8 104618533 missense probably benign 0.28
R6755:Cdh16 UTSW 8 104619248 missense probably damaging 1.00
R6913:Cdh16 UTSW 8 104622264 missense probably benign 0.00
R7037:Cdh16 UTSW 8 104617635 nonsense probably null
R7202:Cdh16 UTSW 8 104614148 missense unknown
R7413:Cdh16 UTSW 8 104619940 missense probably benign 0.00
R7460:Cdh16 UTSW 8 104622291 missense possibly damaging 0.88
RF005:Cdh16 UTSW 8 104617052 missense probably damaging 1.00
RF024:Cdh16 UTSW 8 104617052 missense probably damaging 1.00
X0067:Cdh16 UTSW 8 104620017 missense probably damaging 1.00
Z1176:Cdh16 UTSW 8 104615185 missense probably damaging 1.00
Z1177:Cdh16 UTSW 8 104623440 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTTCCAGAGCATCCAGCCAAGAAG -3'
(R):5'- AGCTATGAGGCAGCTCCTGATCAC -3'

Sequencing Primer
(F):5'- GCAAAGACTCAGGTACAGTTTC -3'
(R):5'- CAGCTCCTGATCACAAGGTG -3'
Posted On2013-05-09