Mutagenetix > Incidental Mutation

Incidental Mutation 'R4420:Irs1'

327028

Institutional Source

Beutler Lab

Gene Symbol

Irs1

Ensembl Gene

ENSMUSG00000055980

Gene Name

insulin receptor substrate 1

Synonyms

G972R, IRS-1

MMRRC Submission

041141-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.647) question?

Stock #

R4420 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82233101-82291416 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 82288450 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 682 (S682G)

Ref Sequence

ENSEMBL: ENSMUSP00000063795 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069799]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069799
AA Change: S682G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: S682G

Domain	Start	End	E-Value	Type
PH	13	117	8.13e-14	SMART
low complexity region	123	143	N/A	INTRINSIC
IRS	155	257	1.19e-35	SMART
PTBI	155	257	7.8e-60	SMART
low complexity region	263	276	N/A	INTRINSIC
low complexity region	378	399	N/A	INTRINSIC
low complexity region	407	419	N/A	INTRINSIC
low complexity region	551	568	N/A	INTRINSIC
low complexity region	662	689	N/A	INTRINSIC
low complexity region	784	794	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC
low complexity region	824	837	N/A	INTRINSIC
low complexity region	1019	1040	N/A	INTRINSIC
low complexity region	1051	1062	N/A	INTRINSIC
low complexity region	1111	1127	N/A	INTRINSIC
low complexity region	1185	1200	N/A	INTRINSIC

Meta Mutation Damage Score

0.0589

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef17	G	A	7: 100,882,308		probably benign	Het
Atp1b1	T	C	1: 164,453,558	T53A	probably damaging	Het
Carmil3	A	G	14: 55,493,588	Q104R	probably damaging	Het
Casz1	T	G	4: 148,948,918	N1382K	possibly damaging	Het
Chfr	T	A	5: 110,170,880	C585*	probably null	Het
Chp2	T	C	7: 122,221,938	F174S	probably damaging	Het
Dclre1c	A	T	2: 3,433,745		probably null	Het
Dnah6	A	G	6: 73,191,479	V487A	probably benign	Het
Dnah9	T	C	11: 66,118,749	R771G	probably benign	Het
Duox1	G	A	2: 122,327,126	A578T	probably benign	Het
Elp3	G	A	14: 65,580,791	A140V	probably damaging	Het
Fbrsl1	T	C	5: 110,378,986	H387R	possibly damaging	Het
Gnat3	T	C	5: 17,999,801	S151P	probably damaging	Het
Gucy1a2	T	A	9: 3,634,640	L228H	probably damaging	Het
Gzmn	A	T	14: 56,166,006	H215Q	probably benign	Het
Heg1	A	T	16: 33,727,435	E864V	probably benign	Het
Hoxb9	T	C	11: 96,271,981	V147A	probably benign	Het
Hsf5	T	G	11: 87,657,304	H604Q	probably benign	Het
Hus1	T	C	11: 9,000,133	E196G	probably damaging	Het
Il12rb2	G	T	6: 67,316,410		probably null	Het
Jcad	T	C	18: 4,676,032	S1265P	probably benign	Het
Kdm1b	C	T	13: 47,063,077	R308W	probably damaging	Het
Matk	A	G	10: 81,262,457	S361G	possibly damaging	Het
Mroh5	TGGAG	TG	15: 73,783,074		probably benign	Het
Nceh1	A	G	3: 27,241,649	D353G	probably damaging	Het
Nqo1	C	T	8: 107,392,117		probably null	Het
Olfr1086	A	G	2: 86,676,919	V138A	possibly damaging	Het
Pcdh7	T	C	5: 58,129,170	I1196T	probably benign	Het
Pla2g4d	A	G	2: 120,284,163	V29A	probably benign	Het
Ppfibp1	T	A	6: 147,026,238	Y794*	probably null	Het
Prdx5	C	A	19: 6,907,964		probably null	Het
Psme4	C	T	11: 30,812,028	T456I	possibly damaging	Het
Ptprd	A	T	4: 76,039,377	S923R	possibly damaging	Het
Samd12	G	A	15: 53,860,259	R13W	probably damaging	Het
Slc35f4	A	T	14: 49,313,577		probably benign	Het
Smc1b	A	G	15: 85,112,830	Y530H	probably damaging	Het
Spata2l	T	C	8: 123,234,029	T174A	possibly damaging	Het
Sugct	C	T	13: 17,452,545	C241Y	probably damaging	Het
Tarbp1	G	T	8: 126,447,080	A965D	possibly damaging	Het
Tas1r3	A	G	4: 155,862,332	V272A	probably damaging	Het
Tas2r117	T	A	6: 132,803,349	L150*	probably null	Het
Trip10	C	T	17: 57,255,448	P322L	probably benign	Het
Wdfy3	A	C	5: 101,910,984	H1487Q	probably damaging	Het
Wdr95	G	A	5: 149,532,666	V8M	probably damaging	Het
Zc3h15	C	A	2: 83,658,012	A98E	probably damaging	Het
Zfp763	T	G	17: 33,018,481	K563N	probably benign	Het
Zmym2	G	A	14: 56,956,878	D1198N	probably damaging	Het
Zp1	C	T	19: 10,914,760		probably null	Het

Other mutations in Irs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Irs1	APN	1	82288483	missense	probably benign	0.01
IGL00534:Irs1	APN	1	82288471	missense	probably benign
IGL01926:Irs1	APN	1	82289959	missense	probably damaging	0.98
IGL02130:Irs1	APN	1	82289467	missense	probably damaging	1.00
IGL03338:Irs1	APN	1	82288401	missense	probably benign	0.05
Hoverboard	UTSW	1	82290098	nonsense	probably null
runt	UTSW	1	82287732	frame shift	probably null
runt2	UTSW	1	82286967	nonsense	probably null
Sprite	UTSW	1	82288109	nonsense	probably null
R0019:Irs1	UTSW	1	82287256	nonsense	probably null
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0318:Irs1	UTSW	1	82288660	missense	probably benign	0.01
R1199:Irs1	UTSW	1	82289626	missense	probably damaging	1.00
R1363:Irs1	UTSW	1	82287288	missense	probably benign	0.02
R1584:Irs1	UTSW	1	82289444	missense	probably benign	0.24
R1874:Irs1	UTSW	1	82289853	frame shift	probably null
R1903:Irs1	UTSW	1	82289461	missense	probably damaging	1.00
R1929:Irs1	UTSW	1	82288459	missense	probably benign
R1986:Irs1	UTSW	1	82288765	missense	probably damaging	1.00
R2136:Irs1	UTSW	1	82290042	missense	probably damaging	1.00
R2179:Irs1	UTSW	1	82290219	missense	possibly damaging	0.81
R2271:Irs1	UTSW	1	82288459	missense	probably benign
R2760:Irs1	UTSW	1	82288570	missense	probably damaging	1.00
R3721:Irs1	UTSW	1	82290085	missense	probably benign	0.11
R3821:Irs1	UTSW	1	82290049	missense	probably benign
R4306:Irs1	UTSW	1	82287964	missense	probably benign	0.11
R4451:Irs1	UTSW	1	82289028	missense	probably benign	0.00
R4479:Irs1	UTSW	1	82287294	missense	probably damaging	1.00
R4771:Irs1	UTSW	1	82287975	missense	probably benign	0.00
R4782:Irs1	UTSW	1	82287463	missense	probably benign	0.00
R4836:Irs1	UTSW	1	82287732	frame shift	probably null
R4880:Irs1	UTSW	1	82287732	frame shift	probably null
R4881:Irs1	UTSW	1	82287732	frame shift	probably null
R5031:Irs1	UTSW	1	82286967	nonsense	probably null
R5053:Irs1	UTSW	1	82286922	missense	probably benign
R5418:Irs1	UTSW	1	82288770	missense	probably damaging	1.00
R5595:Irs1	UTSW	1	82289925	missense	probably damaging	1.00
R5698:Irs1	UTSW	1	82288734	missense	probably benign	0.01
R6381:Irs1	UTSW	1	82287684	missense	possibly damaging	0.66
R6563:Irs1	UTSW	1	82288407	missense	probably damaging	0.98
R7002:Irs1	UTSW	1	82288260	missense	probably benign	0.13
R7095:Irs1	UTSW	1	82290098	nonsense	probably null
R7195:Irs1	UTSW	1	82287456	missense	probably benign	0.13
R7216:Irs1	UTSW	1	82289755	missense	probably damaging	0.98
R7361:Irs1	UTSW	1	82289114	nonsense	probably null
R7490:Irs1	UTSW	1	82287264	missense	probably damaging	0.99
R7540:Irs1	UTSW	1	82288002	missense	not run
R7706:Irs1	UTSW	1	82287691	missense	probably damaging	1.00
R7910:Irs1	UTSW	1	82290081	missense	probably benign	0.06
R7912:Irs1	UTSW	1	82289884	missense	probably benign
R7962:Irs1	UTSW	1	82288722	missense	possibly damaging	0.57
R8139:Irs1	UTSW	1	82289739	missense	probably damaging	1.00
R8158:Irs1	UTSW	1	82289533	missense	probably damaging	1.00
R8159:Irs1	UTSW	1	82288569	missense	probably damaging	1.00
R8187:Irs1	UTSW	1	82288300	missense	probably damaging	1.00
R8288:Irs1	UTSW	1	82287961	nonsense	probably null
R8436:Irs1	UTSW	1	82290249	missense	possibly damaging	0.96
R8865:Irs1	UTSW	1	82288109	nonsense	probably null
R8950:Irs1	UTSW	1	82286931	missense	probably benign
R9591:Irs1	UTSW	1	82288248	missense	probably benign	0.00
X0063:Irs1	UTSW	1	82288908	missense	probably damaging	1.00
X0065:Irs1	UTSW	1	82289365	missense	probably damaging	1.00
Z1177:Irs1	UTSW	1	82288996	missense	possibly damaging	0.87
Z1177:Irs1	UTSW	1	82290394	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- TAAGAGAGGACCGGCTTGTG -3'
(R):5'- GGGACTATATGCCCATGAGC -3'

Sequencing Primer
(F):5'- CCATAGTAGCATTCTGAGGGGC -3'
(R):5'- CATGAGCCCCAAGAGTGTATCTG -3'

Posted On

2015-07-07