Incidental Mutation 'R4420:Olfr1086'
ID327033
Institutional Source Beutler Lab
Gene Symbol Olfr1086
Ensembl Gene ENSMUSG00000075175
Gene Nameolfactory receptor 1086
SynonymsGA_x6K02T2Q125-48168771-48167839, MOR179-2
MMRRC Submission 041141-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R4420 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86676218-86680092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86676919 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 138 (V138A)
Ref Sequence ENSEMBL: ENSMUSP00000150094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099878] [ENSMUST00000213198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099878
AA Change: V138A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097463
Gene: ENSMUSG00000075175
AA Change: V138A

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 3.3e-49 PFAM
Pfam:7tm_1 39 288 1.4e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213198
AA Change: V138A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.1202 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef17 G A 7: 100,882,308 probably benign Het
Atp1b1 T C 1: 164,453,558 T53A probably damaging Het
Carmil3 A G 14: 55,493,588 Q104R probably damaging Het
Casz1 T G 4: 148,948,918 N1382K possibly damaging Het
Chfr T A 5: 110,170,880 C585* probably null Het
Chp2 T C 7: 122,221,938 F174S probably damaging Het
Dclre1c A T 2: 3,433,745 probably null Het
Dnah6 A G 6: 73,191,479 V487A probably benign Het
Dnah9 T C 11: 66,118,749 R771G probably benign Het
Duox1 G A 2: 122,327,126 A578T probably benign Het
Elp3 G A 14: 65,580,791 A140V probably damaging Het
Fbrsl1 T C 5: 110,378,986 H387R possibly damaging Het
Gnat3 T C 5: 17,999,801 S151P probably damaging Het
Gucy1a2 T A 9: 3,634,640 L228H probably damaging Het
Gzmn A T 14: 56,166,006 H215Q probably benign Het
Heg1 A T 16: 33,727,435 E864V probably benign Het
Hoxb9 T C 11: 96,271,981 V147A probably benign Het
Hsf5 T G 11: 87,657,304 H604Q probably benign Het
Hus1 T C 11: 9,000,133 E196G probably damaging Het
Il12rb2 G T 6: 67,316,410 probably null Het
Irs1 T C 1: 82,288,450 S682G possibly damaging Het
Jcad T C 18: 4,676,032 S1265P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Matk A G 10: 81,262,457 S361G possibly damaging Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Nceh1 A G 3: 27,241,649 D353G probably damaging Het
Nqo1 C T 8: 107,392,117 probably null Het
Pcdh7 T C 5: 58,129,170 I1196T probably benign Het
Pla2g4d A G 2: 120,284,163 V29A probably benign Het
Ppfibp1 T A 6: 147,026,238 Y794* probably null Het
Prdx5 C A 19: 6,907,964 probably null Het
Psme4 C T 11: 30,812,028 T456I possibly damaging Het
Ptprd A T 4: 76,039,377 S923R possibly damaging Het
Samd12 G A 15: 53,860,259 R13W probably damaging Het
Slc35f4 A T 14: 49,313,577 probably benign Het
Smc1b A G 15: 85,112,830 Y530H probably damaging Het
Spata2l T C 8: 123,234,029 T174A possibly damaging Het
Sugct C T 13: 17,452,545 C241Y probably damaging Het
Tarbp1 G T 8: 126,447,080 A965D possibly damaging Het
Tas1r3 A G 4: 155,862,332 V272A probably damaging Het
Tas2r117 T A 6: 132,803,349 L150* probably null Het
Trip10 C T 17: 57,255,448 P322L probably benign Het
Wdfy3 A C 5: 101,910,984 H1487Q probably damaging Het
Wdr95 G A 5: 149,532,666 V8M probably damaging Het
Zc3h15 C A 2: 83,658,012 A98E probably damaging Het
Zfp763 T G 17: 33,018,481 K563N probably benign Het
Zmym2 G A 14: 56,956,878 D1198N probably damaging Het
Zp1 C T 19: 10,914,760 probably null Het
Other mutations in Olfr1086
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Olfr1086 APN 2 86677081 missense probably benign 0.00
R0492:Olfr1086 UTSW 2 86676490 missense probably damaging 1.00
R0629:Olfr1086 UTSW 2 86676529 missense possibly damaging 0.65
R1114:Olfr1086 UTSW 2 86677285 missense possibly damaging 0.72
R1341:Olfr1086 UTSW 2 86677163 missense possibly damaging 0.86
R1868:Olfr1086 UTSW 2 86677285 missense possibly damaging 0.72
R2183:Olfr1086 UTSW 2 86677036 missense probably benign 0.21
R3159:Olfr1086 UTSW 2 86676511 missense probably benign 0.03
R4061:Olfr1086 UTSW 2 86676818 missense probably damaging 1.00
R5514:Olfr1086 UTSW 2 86676881 missense probably benign 0.03
R7066:Olfr1086 UTSW 2 86677226 missense possibly damaging 0.95
R7077:Olfr1086 UTSW 2 86676892 missense possibly damaging 0.78
R7246:Olfr1086 UTSW 2 86677289 missense probably benign 0.11
R7383:Olfr1086 UTSW 2 86676919 missense possibly damaging 0.95
R8062:Olfr1086 UTSW 2 86677066 missense probably benign 0.01
X0064:Olfr1086 UTSW 2 86677199 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGATTGAAGTGGGTGTCAGAAC -3'
(R):5'- GAGTGTGCTGTCCTCAGTAGAC -3'

Sequencing Primer
(F):5'- TGGGTGTCAGAACATGAAATTGCC -3'
(R):5'- CACCCCACAAATGGTAGTTGACTTTG -3'
Posted On2015-07-07