Incidental Mutation 'R4420:Pla2g4d'
ID 327034
Institutional Source Beutler Lab
Gene Symbol Pla2g4d
Ensembl Gene ENSMUSG00000070719
Gene Name phospholipase A2, group IVD
Synonyms Pla2delta, 2610311B01Rik
MMRRC Submission 041141-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R4420 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 120096347-120119678 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120114644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 29 (V29A)
Ref Sequence ENSEMBL: ENSMUSP00000092252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094665]
AlphaFold Q50L43
Predicted Effect probably benign
Transcript: ENSMUST00000094665
AA Change: V29A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092252
Gene: ENSMUSG00000070719
AA Change: V29A

DomainStartEndE-ValueType
C2 32 132 1.12e-18 SMART
PLAc 263 766 3.36e-11 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The phospholipase A2 enzyme family, including PLA2G4D, catalyze the hydrolysis of glycerophospholipids at the sn-2 position and then liberate free fatty acids and lysophospholipids (Chiba et al., 2004 [PubMed 14709560]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef17 G A 7: 100,531,515 (GRCm39) probably benign Het
Atp1b1 T C 1: 164,281,127 (GRCm39) T53A probably damaging Het
Carmil3 A G 14: 55,731,045 (GRCm39) Q104R probably damaging Het
Casz1 T G 4: 149,033,375 (GRCm39) N1382K possibly damaging Het
Chfr T A 5: 110,318,746 (GRCm39) C585* probably null Het
Chp2 T C 7: 121,821,161 (GRCm39) F174S probably damaging Het
Dclre1c A T 2: 3,434,782 (GRCm39) probably null Het
Dnah6 A G 6: 73,168,462 (GRCm39) V487A probably benign Het
Dnah9 T C 11: 66,009,575 (GRCm39) R771G probably benign Het
Duox1 G A 2: 122,157,607 (GRCm39) A578T probably benign Het
Elp3 G A 14: 65,818,240 (GRCm39) A140V probably damaging Het
Fbrsl1 T C 5: 110,526,852 (GRCm39) H387R possibly damaging Het
Gnat3 T C 5: 18,204,799 (GRCm39) S151P probably damaging Het
Gucy1a2 T A 9: 3,634,640 (GRCm39) L228H probably damaging Het
Gzmn A T 14: 56,403,463 (GRCm39) H215Q probably benign Het
Heg1 A T 16: 33,547,805 (GRCm39) E864V probably benign Het
Hoxb9 T C 11: 96,162,807 (GRCm39) V147A probably benign Het
Hsf5 T G 11: 87,548,130 (GRCm39) H604Q probably benign Het
Hus1 T C 11: 8,950,133 (GRCm39) E196G probably damaging Het
Il12rb2 G T 6: 67,293,394 (GRCm39) probably null Het
Irs1 T C 1: 82,266,171 (GRCm39) S682G possibly damaging Het
Jcad T C 18: 4,676,032 (GRCm39) S1265P probably benign Het
Kdm1b C T 13: 47,216,553 (GRCm39) R308W probably damaging Het
Matk A G 10: 81,098,291 (GRCm39) S361G possibly damaging Het
Mroh5 TGGAG TG 15: 73,654,923 (GRCm39) probably benign Het
Nceh1 A G 3: 27,295,798 (GRCm39) D353G probably damaging Het
Nqo1 C T 8: 108,118,749 (GRCm39) probably null Het
Or5t7 A G 2: 86,507,263 (GRCm39) V138A possibly damaging Het
Pcdh7 T C 5: 58,286,512 (GRCm39) I1196T probably benign Het
Ppfibp1 T A 6: 146,927,736 (GRCm39) Y794* probably null Het
Prdx5 C A 19: 6,885,332 (GRCm39) probably null Het
Psme4 C T 11: 30,762,028 (GRCm39) T456I possibly damaging Het
Ptprd A T 4: 75,957,614 (GRCm39) S923R possibly damaging Het
Samd12 G A 15: 53,723,655 (GRCm39) R13W probably damaging Het
Slc35f4 A T 14: 49,551,034 (GRCm39) probably benign Het
Smc1b A G 15: 84,997,031 (GRCm39) Y530H probably damaging Het
Spata2l T C 8: 123,960,768 (GRCm39) T174A possibly damaging Het
Sugct C T 13: 17,627,130 (GRCm39) C241Y probably damaging Het
Tarbp1 G T 8: 127,173,819 (GRCm39) A965D possibly damaging Het
Tas1r3 A G 4: 155,946,789 (GRCm39) V272A probably damaging Het
Tas2r117 T A 6: 132,780,312 (GRCm39) L150* probably null Het
Trip10 C T 17: 57,562,448 (GRCm39) P322L probably benign Het
Wdfy3 A C 5: 102,058,850 (GRCm39) H1487Q probably damaging Het
Wdr95 G A 5: 149,456,131 (GRCm39) V8M probably damaging Het
Zc3h15 C A 2: 83,488,356 (GRCm39) A98E probably damaging Het
Zfp763 T G 17: 33,237,455 (GRCm39) K563N probably benign Het
Zmym2 G A 14: 57,194,335 (GRCm39) D1198N probably damaging Het
Zp1 C T 19: 10,892,124 (GRCm39) probably null Het
Other mutations in Pla2g4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pla2g4d APN 2 120,112,207 (GRCm39) missense probably damaging 1.00
IGL01405:Pla2g4d APN 2 120,097,304 (GRCm39) missense probably benign 0.01
IGL01642:Pla2g4d APN 2 120,111,117 (GRCm39) missense probably damaging 1.00
IGL01657:Pla2g4d APN 2 120,105,768 (GRCm39) missense possibly damaging 0.91
BB001:Pla2g4d UTSW 2 120,119,645 (GRCm39) start gained probably benign
R0962:Pla2g4d UTSW 2 120,111,098 (GRCm39) critical splice donor site probably null
R1564:Pla2g4d UTSW 2 120,099,384 (GRCm39) missense possibly damaging 0.76
R1576:Pla2g4d UTSW 2 120,114,648 (GRCm39) missense probably damaging 1.00
R1667:Pla2g4d UTSW 2 120,100,631 (GRCm39) splice site probably benign
R1680:Pla2g4d UTSW 2 120,108,231 (GRCm39) critical splice donor site probably null
R1712:Pla2g4d UTSW 2 120,107,971 (GRCm39) missense possibly damaging 0.51
R2253:Pla2g4d UTSW 2 120,101,622 (GRCm39) missense probably damaging 0.99
R2919:Pla2g4d UTSW 2 120,112,108 (GRCm39) splice site probably benign
R3122:Pla2g4d UTSW 2 120,109,384 (GRCm39) missense probably benign 0.03
R4737:Pla2g4d UTSW 2 120,097,271 (GRCm39) missense probably benign 0.00
R4829:Pla2g4d UTSW 2 120,097,224 (GRCm39) missense probably damaging 1.00
R5032:Pla2g4d UTSW 2 120,112,176 (GRCm39) nonsense probably null
R5530:Pla2g4d UTSW 2 120,100,036 (GRCm39) missense probably benign 0.06
R5677:Pla2g4d UTSW 2 120,109,429 (GRCm39) missense possibly damaging 0.87
R6087:Pla2g4d UTSW 2 120,100,487 (GRCm39) missense probably damaging 1.00
R6088:Pla2g4d UTSW 2 120,100,487 (GRCm39) missense probably damaging 1.00
R6150:Pla2g4d UTSW 2 120,100,045 (GRCm39) missense probably damaging 1.00
R6930:Pla2g4d UTSW 2 120,101,114 (GRCm39) missense probably damaging 1.00
R7240:Pla2g4d UTSW 2 120,100,830 (GRCm39) missense probably damaging 1.00
R7284:Pla2g4d UTSW 2 120,114,617 (GRCm39) missense probably damaging 1.00
R7339:Pla2g4d UTSW 2 120,109,459 (GRCm39) missense probably benign
R7552:Pla2g4d UTSW 2 120,114,620 (GRCm39) missense possibly damaging 0.56
R7607:Pla2g4d UTSW 2 120,119,457 (GRCm39) missense probably benign
R7692:Pla2g4d UTSW 2 120,109,776 (GRCm39) missense possibly damaging 0.84
R7860:Pla2g4d UTSW 2 120,097,211 (GRCm39) missense probably benign 0.13
R7924:Pla2g4d UTSW 2 120,119,645 (GRCm39) start gained probably benign
R7972:Pla2g4d UTSW 2 120,109,413 (GRCm39) missense probably benign 0.04
R8373:Pla2g4d UTSW 2 120,107,980 (GRCm39) missense probably null 1.00
R8737:Pla2g4d UTSW 2 120,100,466 (GRCm39) missense probably damaging 1.00
R8752:Pla2g4d UTSW 2 120,099,248 (GRCm39) critical splice donor site probably null
R8987:Pla2g4d UTSW 2 120,100,442 (GRCm39) missense probably damaging 1.00
R9221:Pla2g4d UTSW 2 120,100,453 (GRCm39) missense possibly damaging 0.76
R9251:Pla2g4d UTSW 2 120,099,378 (GRCm39) missense possibly damaging 0.87
R9740:Pla2g4d UTSW 2 120,107,952 (GRCm39) missense probably damaging 1.00
X0026:Pla2g4d UTSW 2 120,107,952 (GRCm39) missense probably damaging 0.99
X0028:Pla2g4d UTSW 2 120,112,207 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCAGGTTCCTTTGACAACC -3'
(R):5'- AATCACTACCCCAGTTGACCTG -3'

Sequencing Primer
(F):5'- AGGTTCCTTTGACAACCCCAGTATC -3'
(R):5'- ATCCCATGGCTGCCAAAGG -3'
Posted On 2015-07-07