Mutagenetix > Incidental Mutations

Incidental Mutation 'R4420:Chfr'

327042

Institutional Source

Beutler Lab

Gene Symbol

Chfr

Ensembl Gene

ENSMUSG00000014668

Gene Name

checkpoint with forkhead and ring finger domains

Synonyms

RNF116, 5730484M20Rik

MMRRC Submission

041141-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.215) question?

Stock #

R4420 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110135842-110171972 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 110170880 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 585 (C585*)

Ref Sequence

ENSEMBL: ENSMUSP00000143480 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198633] [ENSMUST00000199557] [ENSMUST00000198066]

AlphaFold

Q810L3

Predicted Effect

probably null
Transcript: ENSMUST00000014812
AA Change: C656*

SMART Domains

Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668
AA Change: C656*

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	512	3.53e0	SMART
Blast:VWA	593	655	3e-12	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000112519
AA Change: C657*

SMART Domains

Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668
AA Change: C657*

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	513	3.63e0	SMART
Blast:VWA	594	656	3e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125250

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130630

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130892

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132210

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135366

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141008

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156579

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197005

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197010

Predicted Effect

probably null
Transcript: ENSMUST00000198633
AA Change: C585*

SMART Domains

Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668
AA Change: C585*

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
RING	231	269	2.63e-4	SMART
low complexity region	324	349	N/A	INTRINSIC
RING	371	441	3.63e0	SMART
Blast:VWA	522	584	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000199557

SMART Domains

Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

Domain	Start	End	E-Value	Type
SCOP:d1lgpa_	14	44	4e-5	SMART
PDB:1LGQ\|B	16	44	1e-10	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000198066

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef17	G	A	7: 100,882,308		probably benign	Het
Atp1b1	T	C	1: 164,453,558	T53A	probably damaging	Het
Carmil3	A	G	14: 55,493,588	Q104R	probably damaging	Het
Casz1	T	G	4: 148,948,918	N1382K	possibly damaging	Het
Chp2	T	C	7: 122,221,938	F174S	probably damaging	Het
Dclre1c	A	T	2: 3,433,745		probably null	Het
Dnah6	A	G	6: 73,191,479	V487A	probably benign	Het
Dnah9	T	C	11: 66,118,749	R771G	probably benign	Het
Duox1	G	A	2: 122,327,126	A578T	probably benign	Het
Elp3	G	A	14: 65,580,791	A140V	probably damaging	Het
Fbrsl1	T	C	5: 110,378,986	H387R	possibly damaging	Het
Gnat3	T	C	5: 17,999,801	S151P	probably damaging	Het
Gucy1a2	T	A	9: 3,634,640	L228H	probably damaging	Het
Gzmn	A	T	14: 56,166,006	H215Q	probably benign	Het
Heg1	A	T	16: 33,727,435	E864V	probably benign	Het
Hoxb9	T	C	11: 96,271,981	V147A	probably benign	Het
Hsf5	T	G	11: 87,657,304	H604Q	probably benign	Het
Hus1	T	C	11: 9,000,133	E196G	probably damaging	Het
Il12rb2	G	T	6: 67,316,410		probably null	Het
Irs1	T	C	1: 82,288,450	S682G	possibly damaging	Het
Jcad	T	C	18: 4,676,032	S1265P	probably benign	Het
Kdm1b	C	T	13: 47,063,077	R308W	probably damaging	Het
Matk	A	G	10: 81,262,457	S361G	possibly damaging	Het
Mroh5	TGGAG	TG	15: 73,783,074		probably benign	Het
Nceh1	A	G	3: 27,241,649	D353G	probably damaging	Het
Nqo1	C	T	8: 107,392,117		probably null	Het
Olfr1086	A	G	2: 86,676,919	V138A	possibly damaging	Het
Pcdh7	T	C	5: 58,129,170	I1196T	probably benign	Het
Pla2g4d	A	G	2: 120,284,163	V29A	probably benign	Het
Ppfibp1	T	A	6: 147,026,238	Y794*	probably null	Het
Prdx5	C	A	19: 6,907,964		probably null	Het
Psme4	C	T	11: 30,812,028	T456I	possibly damaging	Het
Ptprd	A	T	4: 76,039,377	S923R	possibly damaging	Het
Samd12	G	A	15: 53,860,259	R13W	probably damaging	Het
Slc35f4	A	T	14: 49,313,577		probably benign	Het
Smc1b	A	G	15: 85,112,830	Y530H	probably damaging	Het
Spata2l	T	C	8: 123,234,029	T174A	possibly damaging	Het
Sugct	C	T	13: 17,452,545	C241Y	probably damaging	Het
Tarbp1	G	T	8: 126,447,080	A965D	possibly damaging	Het
Tas1r3	A	G	4: 155,862,332	V272A	probably damaging	Het
Tas2r117	T	A	6: 132,803,349	L150*	probably null	Het
Trip10	C	T	17: 57,255,448	P322L	probably benign	Het
Wdfy3	A	C	5: 101,910,984	H1487Q	probably damaging	Het
Wdr95	G	A	5: 149,532,666	V8M	probably damaging	Het
Zc3h15	C	A	2: 83,658,012	A98E	probably damaging	Het
Zfp763	T	G	17: 33,018,481	K563N	probably benign	Het
Zmym2	G	A	14: 56,956,878	D1198N	probably damaging	Het
Zp1	C	T	19: 10,914,760		probably null	Het

Other mutations in Chfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01333:Chfr	APN	5	110143573	missense	possibly damaging	0.94
IGL01479:Chfr	APN	5	110144993	unclassified	probably benign
IGL02543:Chfr	APN	5	110143547	splice site	probably null
IGL02657:Chfr	APN	5	110154839	missense	probably damaging	1.00
IGL03057:Chfr	APN	5	110143609	missense	probably benign	0.14
PIT4445001:Chfr	UTSW	5	110151677	missense	possibly damaging	0.88
R0938:Chfr	UTSW	5	110164058	missense	probably damaging	1.00
R1346:Chfr	UTSW	5	110140447	missense	probably damaging	1.00
R1561:Chfr	UTSW	5	110158808	missense	probably benign	0.05
R1602:Chfr	UTSW	5	110151665	missense	probably benign	0.26
R1658:Chfr	UTSW	5	110153169	missense	probably damaging	1.00
R2134:Chfr	UTSW	5	110144761	splice site	probably null
R2234:Chfr	UTSW	5	110170863	missense	probably damaging	1.00
R4371:Chfr	UTSW	5	110136168	missense	probably damaging	0.99
R4666:Chfr	UTSW	5	110144867	nonsense	probably null
R4742:Chfr	UTSW	5	110143598	missense	probably benign	0.04
R4809:Chfr	UTSW	5	110158834	missense	probably damaging	1.00
R5490:Chfr	UTSW	5	110153129	missense	possibly damaging	0.88
R5581:Chfr	UTSW	5	110153282	critical splice donor site	probably null
R5820:Chfr	UTSW	5	110162739	missense	possibly damaging	0.94
R6012:Chfr	UTSW	5	110144651	critical splice donor site	probably null
R7128:Chfr	UTSW	5	110143636	missense	probably benign	0.33
R7166:Chfr	UTSW	5	110158805	missense	probably benign
R7278:Chfr	UTSW	5	110140360	missense	probably benign	0.23
R7393:Chfr	UTSW	5	110152358	missense	probably damaging	0.98
R7422:Chfr	UTSW	5	110162705	splice site	probably null
R7499:Chfr	UTSW	5	110151683	missense	probably benign	0.40
R8224:Chfr	UTSW	5	110160243	critical splice donor site	probably null
R8264:Chfr	UTSW	5	110152434	missense	possibly damaging	0.86
R8325:Chfr	UTSW	5	110162763	nonsense	probably null
R8333:Chfr	UTSW	5	110154937	missense	probably benign	0.05
R8823:Chfr	UTSW	5	110152392	missense	probably damaging	0.96
R9024:Chfr	UTSW	5	110158832	missense	probably benign	0.26
R9419:Chfr	UTSW	5	110169190	missense	probably damaging	1.00
X0013:Chfr	UTSW	5	110151579	missense	probably benign	0.19
Z1176:Chfr	UTSW	5	110144895	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGGCACAGCTCTTGTTCTATG -3'
(R):5'- GACGATGACGCTCCACAAAG -3'

Sequencing Primer
(F):5'- AGACAACTTAGTTTGGCTCCCAG -3'
(R):5'- GATGACGCTCCACAAAGGGAAAATC -3'

Posted On

2015-07-07