Mutagenetix > Incidental Mutations

Incidental Mutation 'R4420:Hus1'

327057

Institutional Source

Beutler Lab

Gene Symbol

Hus1

Ensembl Gene

ENSMUSG00000020413

Gene Name

HUS1 checkpoint clamp component

Synonyms

MMRRC Submission

041141-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4420 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8993137-9011191 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 9000133 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 196 (E196G)

Ref Sequence

ENSEMBL: ENSMUSP00000114339 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020683] [ENSMUST00000129115]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020683
AA Change: E196G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000020683
Gene: ENSMUSG00000020413
AA Change: E196G

Domain	Start	End	E-Value	Type
Pfam:Hus1	1	280	5.1e-86	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000129115
AA Change: E196G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000114339
Gene: ENSMUSG00000020413
AA Change: E196G

Domain	Start	End	E-Value	Type
Pfam:Hus1	1	280	4.8e-89	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139877

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146002

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152890

Meta Mutation Damage Score

0.7851

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: This gene encodes a component of a cell cycle checkpoint complex that causes cell cycle arrest in response to bulky DNA lesions and DNA replication blockage. Together with the proteins Rad9 and Rad1, the encoded protein forms a heterotrimeric complex known as the 9-1-1 complex. Mice lacking the encoded protein develop spontaneous chromosomal abnormalities resulting in embryonic lethality. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in yolk sac vascularization, placental abnormalities, extensive apoptosis, and midgestational lethality. Mutant cells show increased chromosomal abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef17	G	A	7: 100,882,308		probably benign	Het
Atp1b1	T	C	1: 164,453,558	T53A	probably damaging	Het
Carmil3	A	G	14: 55,493,588	Q104R	probably damaging	Het
Casz1	T	G	4: 148,948,918	N1382K	possibly damaging	Het
Chfr	T	A	5: 110,170,880	C585*	probably null	Het
Chp2	T	C	7: 122,221,938	F174S	probably damaging	Het
Dclre1c	A	T	2: 3,433,745		probably null	Het
Dnah6	A	G	6: 73,191,479	V487A	probably benign	Het
Dnah9	T	C	11: 66,118,749	R771G	probably benign	Het
Duox1	G	A	2: 122,327,126	A578T	probably benign	Het
Elp3	G	A	14: 65,580,791	A140V	probably damaging	Het
Fbrsl1	T	C	5: 110,378,986	H387R	possibly damaging	Het
Gnat3	T	C	5: 17,999,801	S151P	probably damaging	Het
Gucy1a2	T	A	9: 3,634,640	L228H	probably damaging	Het
Gzmn	A	T	14: 56,166,006	H215Q	probably benign	Het
Heg1	A	T	16: 33,727,435	E864V	probably benign	Het
Hoxb9	T	C	11: 96,271,981	V147A	probably benign	Het
Hsf5	T	G	11: 87,657,304	H604Q	probably benign	Het
Il12rb2	G	T	6: 67,316,410		probably null	Het
Irs1	T	C	1: 82,288,450	S682G	possibly damaging	Het
Jcad	T	C	18: 4,676,032	S1265P	probably benign	Het
Kdm1b	C	T	13: 47,063,077	R308W	probably damaging	Het
Matk	A	G	10: 81,262,457	S361G	possibly damaging	Het
Mroh5	TGGAG	TG	15: 73,783,074		probably benign	Het
Nceh1	A	G	3: 27,241,649	D353G	probably damaging	Het
Nqo1	C	T	8: 107,392,117		probably null	Het
Olfr1086	A	G	2: 86,676,919	V138A	possibly damaging	Het
Pcdh7	T	C	5: 58,129,170	I1196T	probably benign	Het
Pla2g4d	A	G	2: 120,284,163	V29A	probably benign	Het
Ppfibp1	T	A	6: 147,026,238	Y794*	probably null	Het
Prdx5	C	A	19: 6,907,964		probably null	Het
Psme4	C	T	11: 30,812,028	T456I	possibly damaging	Het
Ptprd	A	T	4: 76,039,377	S923R	possibly damaging	Het
Samd12	G	A	15: 53,860,259	R13W	probably damaging	Het
Slc35f4	A	T	14: 49,313,577		probably benign	Het
Smc1b	A	G	15: 85,112,830	Y530H	probably damaging	Het
Spata2l	T	C	8: 123,234,029	T174A	possibly damaging	Het
Sugct	C	T	13: 17,452,545	C241Y	probably damaging	Het
Tarbp1	G	T	8: 126,447,080	A965D	possibly damaging	Het
Tas1r3	A	G	4: 155,862,332	V272A	probably damaging	Het
Tas2r117	T	A	6: 132,803,349	L150*	probably null	Het
Trip10	C	T	17: 57,255,448	P322L	probably benign	Het
Wdfy3	A	C	5: 101,910,984	H1487Q	probably damaging	Het
Wdr95	G	A	5: 149,532,666	V8M	probably damaging	Het
Zc3h15	C	A	2: 83,658,012	A98E	probably damaging	Het
Zfp763	T	G	17: 33,018,481	K563N	probably benign	Het
Zmym2	G	A	14: 56,956,878	D1198N	probably damaging	Het
Zp1	C	T	19: 10,914,760		probably null	Het

Other mutations in Hus1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01543:Hus1	APN	11	9000082	missense	probably benign	0.00
IGL01974:Hus1	APN	11	9000088	missense	possibly damaging	0.58
IGL02301:Hus1	APN	11	8996915	missense	probably benign
IGL02436:Hus1	APN	11	9006057	missense	possibly damaging	0.93
R0694:Hus1	UTSW	11	9007531	nonsense	probably null
R2108:Hus1	UTSW	11	9011110	start codon destroyed	probably null	1.00
R2128:Hus1	UTSW	11	9006011	missense	probably damaging	1.00
R2329:Hus1	UTSW	11	9007492	critical splice donor site	probably null
R4363:Hus1	UTSW	11	8998676	missense	probably damaging	1.00
R4453:Hus1	UTSW	11	9006035	missense	probably damaging	1.00
R4572:Hus1	UTSW	11	9007617	splice site	probably null
R4818:Hus1	UTSW	11	8996808	utr 3 prime	probably benign
R4913:Hus1	UTSW	11	8996856	missense	probably benign	0.03
R4989:Hus1	UTSW	11	9006027	missense	probably damaging	0.97
R5402:Hus1	UTSW	11	9010240	critical splice donor site	probably null
R5902:Hus1	UTSW	11	9010669	intron	probably benign
R6402:Hus1	UTSW	11	9010407	missense	probably damaging	1.00
R7792:Hus1	UTSW	11	9000133	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAATCTAAGCCCCTTCTCAAATGGG -3'
(R):5'- TAAGCCTTTGTCAGCACTCC -3'

Sequencing Primer
(F):5'- GCCCCTTCTCAAATGGGAAACAAAG -3'
(R):5'- TTTGTCAGCACTCCTGGGAGAC -3'

Posted On

2015-07-07