Mutagenetix > Incidental Mutations

Incidental Mutation 'R4420:Carmil3'

327065

Institutional Source

Beutler Lab

Gene Symbol

Carmil3

Ensembl Gene

ENSMUSG00000022211

Gene Name

capping protein regulator and myosin 1 linker 3

Synonyms

Lrrc16b

MMRRC Submission

041141-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.248) question?

Stock #

R4420 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55490651-55508272 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55493588 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 104 (Q104R)

Ref Sequence

ENSEMBL: ENSMUSP00000154517 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022821] [ENSMUST00000076236] [ENSMUST00000226757] [ENSMUST00000228877]

Predicted Effect

probably benign
Transcript: ENSMUST00000022821

SMART Domains

Protein: ENSMUSP00000022821
Gene: ENSMUSG00000022210

Domain	Start	End	E-Value	Type
Pfam:adh_short	34	229	7.8e-54	PFAM
Pfam:KR	35	210	8.4e-14	PFAM
Pfam:adh_short_C2	39	276	7.9e-38	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000076236
AA Change: Q104R

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000075587
Gene: ENSMUSG00000022211
AA Change: Q104R

Domain	Start	End	E-Value	Type
low complexity region	138	151	N/A	INTRINSIC
internal_repeat_1	203	297	7.56e-6	PROSPERO
Blast:LRR	333	362	5e-10	BLAST
Blast:LRR	423	446	1e-5	BLAST
low complexity region	447	462	N/A	INTRINSIC
low complexity region	468	479	N/A	INTRINSIC
internal_repeat_1	496	593	7.56e-6	PROSPERO
Pfam:CARMIL_C	778	1065	5.3e-76	PFAM
low complexity region	1068	1117	N/A	INTRINSIC
low complexity region	1137	1146	N/A	INTRINSIC
low complexity region	1204	1216	N/A	INTRINSIC
low complexity region	1318	1329	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226388

Predicted Effect

probably benign
Transcript: ENSMUST00000226446

Predicted Effect

probably damaging
Transcript: ENSMUST00000226757
AA Change: Q104R

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000226902

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227070

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227312

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227542

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227563

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228760

Predicted Effect

possibly damaging
Transcript: ENSMUST00000228877
AA Change: Q104R

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

Meta Mutation Damage Score

0.1195

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

96% (53/55)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef17	G	A	7: 100,882,308		probably benign	Het
Atp1b1	T	C	1: 164,453,558	T53A	probably damaging	Het
Casz1	T	G	4: 148,948,918	N1382K	possibly damaging	Het
Chfr	T	A	5: 110,170,880	C585*	probably null	Het
Chp2	T	C	7: 122,221,938	F174S	probably damaging	Het
Dclre1c	A	T	2: 3,433,745		probably null	Het
Dnah6	A	G	6: 73,191,479	V487A	probably benign	Het
Dnah9	T	C	11: 66,118,749	R771G	probably benign	Het
Duox1	G	A	2: 122,327,126	A578T	probably benign	Het
Elp3	G	A	14: 65,580,791	A140V	probably damaging	Het
Fbrsl1	T	C	5: 110,378,986	H387R	possibly damaging	Het
Gnat3	T	C	5: 17,999,801	S151P	probably damaging	Het
Gucy1a2	T	A	9: 3,634,640	L228H	probably damaging	Het
Gzmn	A	T	14: 56,166,006	H215Q	probably benign	Het
Heg1	A	T	16: 33,727,435	E864V	probably benign	Het
Hoxb9	T	C	11: 96,271,981	V147A	probably benign	Het
Hsf5	T	G	11: 87,657,304	H604Q	probably benign	Het
Hus1	T	C	11: 9,000,133	E196G	probably damaging	Het
Il12rb2	G	T	6: 67,316,410		probably null	Het
Irs1	T	C	1: 82,288,450	S682G	possibly damaging	Het
Jcad	T	C	18: 4,676,032	S1265P	probably benign	Het
Kdm1b	C	T	13: 47,063,077	R308W	probably damaging	Het
Matk	A	G	10: 81,262,457	S361G	possibly damaging	Het
Mroh5	TGGAG	TG	15: 73,783,074		probably benign	Het
Nceh1	A	G	3: 27,241,649	D353G	probably damaging	Het
Nqo1	C	T	8: 107,392,117		probably null	Het
Olfr1086	A	G	2: 86,676,919	V138A	possibly damaging	Het
Pcdh7	T	C	5: 58,129,170	I1196T	probably benign	Het
Pla2g4d	A	G	2: 120,284,163	V29A	probably benign	Het
Ppfibp1	T	A	6: 147,026,238	Y794*	probably null	Het
Prdx5	C	A	19: 6,907,964		probably null	Het
Psme4	C	T	11: 30,812,028	T456I	possibly damaging	Het
Ptprd	A	T	4: 76,039,377	S923R	possibly damaging	Het
Samd12	G	A	15: 53,860,259	R13W	probably damaging	Het
Slc35f4	A	T	14: 49,313,577		probably benign	Het
Smc1b	A	G	15: 85,112,830	Y530H	probably damaging	Het
Spata2l	T	C	8: 123,234,029	T174A	possibly damaging	Het
Sugct	C	T	13: 17,452,545	C241Y	probably damaging	Het
Tarbp1	G	T	8: 126,447,080	A965D	possibly damaging	Het
Tas1r3	A	G	4: 155,862,332	V272A	probably damaging	Het
Tas2r117	T	A	6: 132,803,349	L150*	probably null	Het
Trip10	C	T	17: 57,255,448	P322L	probably benign	Het
Wdfy3	A	C	5: 101,910,984	H1487Q	probably damaging	Het
Wdr95	G	A	5: 149,532,666	V8M	probably damaging	Het
Zc3h15	C	A	2: 83,658,012	A98E	probably damaging	Het
Zfp763	T	G	17: 33,018,481	K563N	probably benign	Het
Zmym2	G	A	14: 56,956,878	D1198N	probably damaging	Het
Zp1	C	T	19: 10,914,760		probably null	Het

Other mutations in Carmil3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Carmil3	APN	14	55498298	missense	probably damaging	0.99
IGL00498:Carmil3	APN	14	55501895	critical splice donor site	probably null
IGL01061:Carmil3	APN	14	55498630	missense	possibly damaging	0.67
IGL01452:Carmil3	APN	14	55496058	missense	probably damaging	0.99
IGL01606:Carmil3	APN	14	55493849	missense	possibly damaging	0.83
IGL01633:Carmil3	APN	14	55494227	missense	possibly damaging	0.84
IGL01977:Carmil3	APN	14	55493536	missense	probably damaging	1.00
IGL02065:Carmil3	APN	14	55493822	splice site	probably benign
IGL02160:Carmil3	APN	14	55493558	missense	possibly damaging	0.70
IGL02491:Carmil3	APN	14	55504517	missense	probably benign	0.00
IGL02567:Carmil3	APN	14	55498882	missense	possibly damaging	0.93
IGL02629:Carmil3	APN	14	55499068	missense	probably damaging	0.97
IGL02720:Carmil3	APN	14	55507410	missense	probably damaging	0.97
IGL03100:Carmil3	APN	14	55494718	missense	probably damaging	0.99
PIT4434001:Carmil3	UTSW	14	55494688	missense	probably null	1.00
R0023:Carmil3	UTSW	14	55492876	missense	probably damaging	1.00
R0023:Carmil3	UTSW	14	55492876	missense	probably damaging	1.00
R0027:Carmil3	UTSW	14	55494403	missense	probably damaging	0.96
R0101:Carmil3	UTSW	14	55497755	splice site	probably benign
R0321:Carmil3	UTSW	14	55502241	missense	possibly damaging	0.63
R0370:Carmil3	UTSW	14	55495442	missense	possibly damaging	0.82
R0465:Carmil3	UTSW	14	55499861	missense	probably damaging	0.99
R0647:Carmil3	UTSW	14	55502435	critical splice donor site	probably null
R1503:Carmil3	UTSW	14	55498280	missense	probably damaging	0.96
R1635:Carmil3	UTSW	14	55496282	missense	possibly damaging	0.91
R1715:Carmil3	UTSW	14	55504532	missense	probably benign	0.02
R1923:Carmil3	UTSW	14	55502404	missense	probably damaging	0.99
R1944:Carmil3	UTSW	14	55498630	missense	probably damaging	0.97
R2513:Carmil3	UTSW	14	55503838	missense	probably damaging	0.98
R2892:Carmil3	UTSW	14	55498313	missense	probably damaging	0.96
R3433:Carmil3	UTSW	14	55507694	missense	probably benign	0.05
R3552:Carmil3	UTSW	14	55507402	missense	possibly damaging	0.86
R3783:Carmil3	UTSW	14	55496976	missense	probably damaging	1.00
R3787:Carmil3	UTSW	14	55496976	missense	probably damaging	1.00
R4181:Carmil3	UTSW	14	55503955	missense	probably benign	0.10
R4285:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4424:Carmil3	UTSW	14	55501471	missense	probably benign
R4506:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4507:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4534:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4535:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4549:Carmil3	UTSW	14	55505664	splice site	probably null
R4574:Carmil3	UTSW	14	55499476	utr 3 prime	probably benign
R4783:Carmil3	UTSW	14	55501321	critical splice donor site	probably null
R4784:Carmil3	UTSW	14	55501321	critical splice donor site	probably null
R5146:Carmil3	UTSW	14	55497179	missense	probably benign	0.02
R5279:Carmil3	UTSW	14	55501571	missense	probably damaging	0.98
R5425:Carmil3	UTSW	14	55493877	missense	probably benign	0.41
R5530:Carmil3	UTSW	14	55493624	missense	probably damaging	0.98
R5534:Carmil3	UTSW	14	55494890	missense	probably damaging	0.97
R5598:Carmil3	UTSW	14	55503999	frame shift	probably null
R5772:Carmil3	UTSW	14	55493239	missense	probably damaging	1.00
R5896:Carmil3	UTSW	14	55503999	frame shift	probably null
R5931:Carmil3	UTSW	14	55498940	missense	probably damaging	0.99
R6048:Carmil3	UTSW	14	55503845	missense	probably benign	0.00
R6103:Carmil3	UTSW	14	55505427	missense	probably benign	0.02
R6258:Carmil3	UTSW	14	55500432	missense	probably damaging	1.00
R6260:Carmil3	UTSW	14	55500432	missense	probably damaging	1.00
R6338:Carmil3	UTSW	14	55499849	missense	possibly damaging	0.83
R6339:Carmil3	UTSW	14	55499849	missense	possibly damaging	0.83
R6646:Carmil3	UTSW	14	55507930	missense	probably damaging	0.97
R6936:Carmil3	UTSW	14	55501561	missense	probably benign	0.04
R7164:Carmil3	UTSW	14	55501282	missense	probably damaging	0.98
R7214:Carmil3	UTSW	14	55498612	missense	probably damaging	1.00
R7223:Carmil3	UTSW	14	55496238	missense	possibly damaging	0.48
R7269:Carmil3	UTSW	14	55493895	missense	probably benign	0.03
R7319:Carmil3	UTSW	14	55494360	missense	probably benign	0.13
R7357:Carmil3	UTSW	14	55491133	start gained	probably benign
R7386:Carmil3	UTSW	14	55497747	critical splice donor site	probably null
R7463:Carmil3	UTSW	14	55502396	missense	probably damaging	1.00
R7598:Carmil3	UTSW	14	55494821	missense	possibly damaging	0.61
R7602:Carmil3	UTSW	14	55501508	missense	probably null	0.00
R7617:Carmil3	UTSW	14	55497891	missense	probably benign	0.06
R7985:Carmil3	UTSW	14	55496952	missense	probably benign	0.03
R8127:Carmil3	UTSW	14	55498244	missense	probably damaging	0.98
R8423:Carmil3	UTSW	14	55499065	missense	probably damaging	1.00
R8465:Carmil3	UTSW	14	55496848	missense	probably damaging	1.00
U24488:Carmil3	UTSW	14	55497179	missense	probably benign	0.02
Z1088:Carmil3	UTSW	14	55501568	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAATGTCCTGGAGATCCGTG -3'
(R):5'- AAGAGACTCTCAGTGCTTCCTG -3'

Sequencing Primer
(F):5'- TGGAGATCCGTGCCTTCAACAC -3'
(R):5'- CATCACGGTGTTTGAGTCTCCAG -3'

Posted On

2015-07-07