Incidental Mutation 'R4420:Gzmn'
ID327066
Institutional Source Beutler Lab
Gene Symbol Gzmn
Ensembl Gene ENSMUSG00000015443
Gene Namegranzyme N
SynonymsGrN
MMRRC Submission 041141-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4420 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56165797-56174599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56166006 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 215 (H215Q)
Ref Sequence ENSEMBL: ENSMUSP00000015587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015587] [ENSMUST00000225535]
Predicted Effect probably benign
Transcript: ENSMUST00000015587
AA Change: H215Q

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000015587
Gene: ENSMUSG00000015443
AA Change: H215Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 20 241 5.89e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224928
Predicted Effect probably benign
Transcript: ENSMUST00000225535
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef17 G A 7: 100,882,308 probably benign Het
Atp1b1 T C 1: 164,453,558 T53A probably damaging Het
Carmil3 A G 14: 55,493,588 Q104R probably damaging Het
Casz1 T G 4: 148,948,918 N1382K possibly damaging Het
Chfr T A 5: 110,170,880 C585* probably null Het
Chp2 T C 7: 122,221,938 F174S probably damaging Het
Dclre1c A T 2: 3,433,745 probably null Het
Dnah6 A G 6: 73,191,479 V487A probably benign Het
Dnah9 T C 11: 66,118,749 R771G probably benign Het
Duox1 G A 2: 122,327,126 A578T probably benign Het
Elp3 G A 14: 65,580,791 A140V probably damaging Het
Fbrsl1 T C 5: 110,378,986 H387R possibly damaging Het
Gnat3 T C 5: 17,999,801 S151P probably damaging Het
Gucy1a2 T A 9: 3,634,640 L228H probably damaging Het
Heg1 A T 16: 33,727,435 E864V probably benign Het
Hoxb9 T C 11: 96,271,981 V147A probably benign Het
Hsf5 T G 11: 87,657,304 H604Q probably benign Het
Hus1 T C 11: 9,000,133 E196G probably damaging Het
Il12rb2 G T 6: 67,316,410 probably null Het
Irs1 T C 1: 82,288,450 S682G possibly damaging Het
Jcad T C 18: 4,676,032 S1265P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Matk A G 10: 81,262,457 S361G possibly damaging Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Nceh1 A G 3: 27,241,649 D353G probably damaging Het
Nqo1 C T 8: 107,392,117 probably null Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Pcdh7 T C 5: 58,129,170 I1196T probably benign Het
Pla2g4d A G 2: 120,284,163 V29A probably benign Het
Ppfibp1 T A 6: 147,026,238 Y794* probably null Het
Prdx5 C A 19: 6,907,964 probably null Het
Psme4 C T 11: 30,812,028 T456I possibly damaging Het
Ptprd A T 4: 76,039,377 S923R possibly damaging Het
Samd12 G A 15: 53,860,259 R13W probably damaging Het
Slc35f4 A T 14: 49,313,577 probably benign Het
Smc1b A G 15: 85,112,830 Y530H probably damaging Het
Spata2l T C 8: 123,234,029 T174A possibly damaging Het
Sugct C T 13: 17,452,545 C241Y probably damaging Het
Tarbp1 G T 8: 126,447,080 A965D possibly damaging Het
Tas1r3 A G 4: 155,862,332 V272A probably damaging Het
Tas2r117 T A 6: 132,803,349 L150* probably null Het
Trip10 C T 17: 57,255,448 P322L probably benign Het
Wdfy3 A C 5: 101,910,984 H1487Q probably damaging Het
Wdr95 G A 5: 149,532,666 V8M probably damaging Het
Zc3h15 C A 2: 83,658,012 A98E probably damaging Het
Zfp763 T G 17: 33,018,481 K563N probably benign Het
Zmym2 G A 14: 56,956,878 D1198N probably damaging Het
Zp1 C T 19: 10,914,760 probably null Het
Other mutations in Gzmn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Gzmn APN 14 56166979 missense probably benign 0.06
IGL01638:Gzmn APN 14 56169019 missense probably benign 0.03
IGL02234:Gzmn APN 14 56169007 splice site probably null
IGL02691:Gzmn APN 14 56166913 missense probably benign 0.10
R0022:Gzmn UTSW 14 56166925 missense probably damaging 1.00
R1589:Gzmn UTSW 14 56165911 missense probably benign 0.05
R3763:Gzmn UTSW 14 56166904 missense probably benign 0.08
R4153:Gzmn UTSW 14 56167842 missense probably damaging 1.00
R4170:Gzmn UTSW 14 56166804 missense possibly damaging 0.73
R5215:Gzmn UTSW 14 56167862 missense probably damaging 1.00
R5307:Gzmn UTSW 14 56167946 missense probably damaging 0.99
R6727:Gzmn UTSW 14 56165975 missense probably damaging 0.99
R7644:Gzmn UTSW 14 56167319 missense probably damaging 1.00
X0023:Gzmn UTSW 14 56167350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGCTCTATGCACTCTGG -3'
(R):5'- AAGGAAAAGTTGGGCCTCC -3'

Sequencing Primer
(F):5'- CTATGCACTCTGGAGGTTATTTATTG -3'
(R):5'- AAAAGTTGGGCCTCCCTGGAG -3'
Posted On2015-07-07