Incidental Mutation 'R0016:Zwint'
ID32707
Institutional Source Beutler Lab
Gene Symbol Zwint
Ensembl Gene ENSMUSG00000019923
Gene NameZW10 interactor
Synonyms2010007E07Rik, D10Ertd749e, 2600001N01Rik
MMRRC Submission 038311-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0016 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location72654845-72674964 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 72657198 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020081] [ENSMUST00000105431] [ENSMUST00000160337] [ENSMUST00000219352]
Predicted Effect probably benign
Transcript: ENSMUST00000020081
SMART Domains Protein: ENSMUSP00000020081
Gene: ENSMUSG00000019923

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:Zwint 35 250 8.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105431
SMART Domains Protein: ENSMUSP00000101071
Gene: ENSMUSG00000019923

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:Zwint 35 250 8.1e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160128
Predicted Effect probably benign
Transcript: ENSMUST00000160337
SMART Domains Protein: ENSMUSP00000124429
Gene: ENSMUSG00000019923

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:Zwint 35 250 4.4e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163046
Predicted Effect probably benign
Transcript: ENSMUST00000219352
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is clearly involved in kinetochore function although an exact role is not known. It interacts with ZW10, another kinetochore protein, possibly regulating the association between ZW10 and kinetochores. The encoded protein localizes to prophase kinetochores before ZW10 does and it remains detectable on the kinetochore until late anaphase. It has a uniform distribution in the cytoplasm of interphase cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,294,800 V1181G probably benign Het
Adamts12 A T 15: 11,217,829 I291F probably damaging Het
Aspm G C 1: 139,479,544 Q2056H probably benign Het
BC067074 T C 13: 113,366,105 Y115H probably damaging Het
C7 A T 15: 5,046,924 V122E probably benign Het
Casp12 A T 9: 5,352,844 Q152L probably null Het
Cdh16 T A 8: 104,617,632 T92S probably benign Het
Chrd G C 16: 20,734,308 V162L possibly damaging Het
Cpne8 A G 15: 90,501,405 probably benign Het
Cyp2j7 T A 4: 96,202,147 I347F probably damaging Het
Cyp4a10 A T 4: 115,521,107 Q130L probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Dgkd T C 1: 87,917,952 S294P probably benign Het
Dnah8 A G 17: 30,663,316 I621V probably benign Het
Dync2h1 A G 9: 7,144,346 probably benign Het
Echdc1 A T 10: 29,322,421 probably benign Het
Elovl3 T A 19: 46,132,158 F30Y probably damaging Het
Fa2h T C 8: 111,393,514 Y80C probably damaging Het
Fam208b A C 13: 3,585,170 probably null Het
Fgd3 C T 13: 49,296,609 D55N probably benign Het
Fhod1 T C 8: 105,331,655 E823G possibly damaging Het
Gapvd1 A G 2: 34,699,913 probably benign Het
Gm17067 A T 7: 42,708,622 I152K probably benign Het
Gm1966 G A 7: 106,603,246 L264F probably benign Het
Gm9833 A T 3: 10,089,319 M383L possibly damaging Het
Kif27 A G 13: 58,354,714 V50A probably damaging Het
Kpna2 T C 11: 106,991,086 T305A probably benign Het
Krtap22-2 A G 16: 89,010,519 probably benign Het
Lrp2bp T A 8: 46,012,031 F62L probably damaging Het
Marf1 G A 16: 14,152,265 H197Y probably damaging Het
Mob3b A G 4: 35,083,947 F81L probably benign Het
Mon2 C T 10: 123,035,546 V389M probably damaging Het
Myh8 A G 11: 67,298,525 K1176E probably damaging Het
Naf1 T C 8: 66,889,055 probably benign Het
Nckap1l A G 15: 103,475,636 T554A probably benign Het
Oog3 A G 4: 144,158,071 Y432H probably damaging Het
Paxbp1 A T 16: 91,036,036 probably benign Het
Phf20 A T 2: 156,267,194 K154* probably null Het
Plekhj1 T C 10: 80,796,416 D74G possibly damaging Het
Plpp4 T C 7: 129,323,424 C128R probably damaging Het
Rcan3 A T 4: 135,418,378 probably null Het
Sh3rf1 T A 8: 61,374,138 M642K probably benign Het
Slc7a1 A G 5: 148,334,583 V522A probably benign Het
Sorbs1 A G 19: 40,314,738 probably benign Het
Spry2 C T 14: 105,893,297 V152M probably benign Het
Srgap2 A G 1: 131,349,462 M349T possibly damaging Het
Stag3 A G 5: 138,291,381 H271R possibly damaging Het
Stat4 T C 1: 52,068,780 V136A probably benign Het
Stc2 A T 11: 31,360,177 D286E probably benign Het
Stk31 T C 6: 49,437,377 Y482H probably damaging Het
Ticrr C T 7: 79,693,792 P1135L probably benign Het
Tmem55b C T 14: 50,928,894 R213Q probably damaging Het
Trim27 A T 13: 21,191,229 E310V probably benign Het
Uvrag T C 7: 98,991,981 K284R probably benign Het
Vmn1r78 A C 7: 12,153,352 S297R probably benign Het
Xylt2 A G 11: 94,669,640 S270P probably damaging Het
Zfhx3 T C 8: 108,950,178 M2620T probably benign Het
Zkscan2 C A 7: 123,499,996 probably benign Het
Other mutations in Zwint
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Zwint APN 10 72657187 critical splice donor site probably null
IGL02334:Zwint APN 10 72654983 splice site probably null
IGL02936:Zwint APN 10 72657124 missense probably damaging 0.98
R0016:Zwint UTSW 10 72657198 unclassified probably benign
R0365:Zwint UTSW 10 72657295 nonsense probably null
R1628:Zwint UTSW 10 72656295 nonsense probably null
R4405:Zwint UTSW 10 72656263 missense probably damaging 1.00
R4850:Zwint UTSW 10 72655956 unclassified probably benign
R5874:Zwint UTSW 10 72656462 intron probably benign
R6019:Zwint UTSW 10 72656853 missense possibly damaging 0.66
R6181:Zwint UTSW 10 72656599 missense probably benign 0.03
R6333:Zwint UTSW 10 72654952 unclassified probably benign
R7880:Zwint UTSW 10 72657092 missense probably benign 0.06
R7963:Zwint UTSW 10 72657092 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGCATTCTCACCCCTTCAGAAGCG -3'
(R):5'- TCAAGTGGACACTGATCTCTCCCC -3'

Sequencing Primer
(F):5'- AGCGTTTGCAGAACCTGA -3'
(R):5'- GTTACTCAACTGACAGGGCTTAC -3'
Posted On2013-05-09