Incidental Mutation 'R4420:Smc1b'
ID327072
Institutional Source Beutler Lab
Gene Symbol Smc1b
Ensembl Gene ENSMUSG00000022432
Gene Namestructural maintenance of chromosomes 1B
SynonymsSMC1beta, Smc1l2
MMRRC Submission 041141-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.694) question?
Stock #R4420 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location85064689-85131964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85112830 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 530 (Y530H)
Ref Sequence ENSEMBL: ENSMUSP00000023068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023068]
Predicted Effect probably damaging
Transcript: ENSMUST00000023068
AA Change: Y530H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023068
Gene: ENSMUSG00000022432
AA Change: Y530H

DomainStartEndE-ValueType
Pfam:AAA_23 7 361 2e-10 PFAM
Pfam:AAA_21 27 372 7.2e-9 PFAM
low complexity region 422 437 N/A INTRINSIC
SMC_hinge 513 629 1.5e-23 SMART
PDB:1W1W|D 1046 1218 3e-42 PDB
Blast:AAA 1063 1217 5e-25 BLAST
SCOP:d1e69a_ 1114 1202 3e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105085
SMART Domains Protein: ENSMUSP00000100709
Gene: ENSMUSG00000078289

DomainStartEndE-ValueType
Pfam:Ribosomal_L23eN 13 64 1.4e-26 PFAM
Pfam:Ribosomal_L23 72 139 4e-18 PFAM
Meta Mutation Damage Score 0.5831 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMC1L2 belongs to a family of proteins required for chromatid cohesion and DNA recombination during meiosis and mitosis (3:Revenkova et al., 2001 [PubMed 11564881]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice display male and female infertility, abnormal male and female meiosis, and arrest of spematogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef17 G A 7: 100,882,308 probably benign Het
Atp1b1 T C 1: 164,453,558 T53A probably damaging Het
Carmil3 A G 14: 55,493,588 Q104R probably damaging Het
Casz1 T G 4: 148,948,918 N1382K possibly damaging Het
Chfr T A 5: 110,170,880 C585* probably null Het
Chp2 T C 7: 122,221,938 F174S probably damaging Het
Dclre1c A T 2: 3,433,745 probably null Het
Dnah6 A G 6: 73,191,479 V487A probably benign Het
Dnah9 T C 11: 66,118,749 R771G probably benign Het
Duox1 G A 2: 122,327,126 A578T probably benign Het
Elp3 G A 14: 65,580,791 A140V probably damaging Het
Fbrsl1 T C 5: 110,378,986 H387R possibly damaging Het
Gnat3 T C 5: 17,999,801 S151P probably damaging Het
Gucy1a2 T A 9: 3,634,640 L228H probably damaging Het
Gzmn A T 14: 56,166,006 H215Q probably benign Het
Heg1 A T 16: 33,727,435 E864V probably benign Het
Hoxb9 T C 11: 96,271,981 V147A probably benign Het
Hsf5 T G 11: 87,657,304 H604Q probably benign Het
Hus1 T C 11: 9,000,133 E196G probably damaging Het
Il12rb2 G T 6: 67,316,410 probably null Het
Irs1 T C 1: 82,288,450 S682G possibly damaging Het
Jcad T C 18: 4,676,032 S1265P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Matk A G 10: 81,262,457 S361G possibly damaging Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Nceh1 A G 3: 27,241,649 D353G probably damaging Het
Nqo1 C T 8: 107,392,117 probably null Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Pcdh7 T C 5: 58,129,170 I1196T probably benign Het
Pla2g4d A G 2: 120,284,163 V29A probably benign Het
Ppfibp1 T A 6: 147,026,238 Y794* probably null Het
Prdx5 C A 19: 6,907,964 probably null Het
Psme4 C T 11: 30,812,028 T456I possibly damaging Het
Ptprd A T 4: 76,039,377 S923R possibly damaging Het
Samd12 G A 15: 53,860,259 R13W probably damaging Het
Slc35f4 A T 14: 49,313,577 probably benign Het
Spata2l T C 8: 123,234,029 T174A possibly damaging Het
Sugct C T 13: 17,452,545 C241Y probably damaging Het
Tarbp1 G T 8: 126,447,080 A965D possibly damaging Het
Tas1r3 A G 4: 155,862,332 V272A probably damaging Het
Tas2r117 T A 6: 132,803,349 L150* probably null Het
Trip10 C T 17: 57,255,448 P322L probably benign Het
Wdfy3 A C 5: 101,910,984 H1487Q probably damaging Het
Wdr95 G A 5: 149,532,666 V8M probably damaging Het
Zc3h15 C A 2: 83,658,012 A98E probably damaging Het
Zfp763 T G 17: 33,018,481 K563N probably benign Het
Zmym2 G A 14: 56,956,878 D1198N probably damaging Het
Zp1 C T 19: 10,914,760 probably null Het
Other mutations in Smc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Smc1b APN 15 85129700 missense possibly damaging 0.95
IGL01293:Smc1b APN 15 85131898 missense probably damaging 1.00
IGL01656:Smc1b APN 15 85114776 missense probably damaging 0.99
IGL01807:Smc1b APN 15 85096745 missense probably damaging 0.97
IGL02094:Smc1b APN 15 85097891 splice site probably benign
IGL02121:Smc1b APN 15 85097985 missense probably benign
IGL02631:Smc1b APN 15 85107003 missense probably damaging 0.98
IGL02678:Smc1b APN 15 85065000 nonsense probably null
IGL03197:Smc1b APN 15 85070863 missense possibly damaging 0.85
IGL03214:Smc1b APN 15 85097946 nonsense probably null
IGL03218:Smc1b APN 15 85089713 missense probably benign 0.07
IGL03232:Smc1b APN 15 85129720 missense possibly damaging 0.68
adamantine UTSW 15 85121641 missense probably benign 0.06
unbreakable UTSW 15 85096658 missense probably benign
E0370:Smc1b UTSW 15 85127581 missense probably damaging 1.00
PIT4812001:Smc1b UTSW 15 85069651 missense possibly damaging 0.91
R0092:Smc1b UTSW 15 85067724 unclassified probably benign
R0106:Smc1b UTSW 15 85070819 missense probably damaging 1.00
R0106:Smc1b UTSW 15 85070819 missense probably damaging 1.00
R0207:Smc1b UTSW 15 85123759 missense probably benign
R0390:Smc1b UTSW 15 85066277 missense probably damaging 1.00
R0440:Smc1b UTSW 15 85112673 splice site probably benign
R0685:Smc1b UTSW 15 85070820 missense possibly damaging 0.92
R1109:Smc1b UTSW 15 85112815 missense probably damaging 0.98
R1392:Smc1b UTSW 15 85107070 splice site probably benign
R1509:Smc1b UTSW 15 85086134 missense probably benign
R1804:Smc1b UTSW 15 85127790 missense possibly damaging 0.90
R1879:Smc1b UTSW 15 85092067 missense probably benign 0.01
R2086:Smc1b UTSW 15 85121851 splice site probably benign
R2143:Smc1b UTSW 15 85123802 missense probably benign
R2158:Smc1b UTSW 15 85121851 splice site probably benign
R2174:Smc1b UTSW 15 85121851 splice site probably benign
R2471:Smc1b UTSW 15 85092017 missense probably damaging 0.98
R3689:Smc1b UTSW 15 85117263 intron probably benign
R3690:Smc1b UTSW 15 85117263 intron probably benign
R4178:Smc1b UTSW 15 85120647 missense possibly damaging 0.94
R4905:Smc1b UTSW 15 85066227 missense probably damaging 1.00
R4919:Smc1b UTSW 15 85117104 intron probably benign
R5114:Smc1b UTSW 15 85064984 missense probably damaging 1.00
R5314:Smc1b UTSW 15 85070865 missense probably benign 0.00
R5476:Smc1b UTSW 15 85086151 missense probably damaging 0.97
R5593:Smc1b UTSW 15 85121641 missense probably benign 0.06
R5690:Smc1b UTSW 15 85112773 missense probably damaging 1.00
R5719:Smc1b UTSW 15 85096658 missense probably benign
R5817:Smc1b UTSW 15 85067783 missense probably damaging 0.99
R5834:Smc1b UTSW 15 85089665 missense probably damaging 1.00
R5930:Smc1b UTSW 15 85086121 missense probably damaging 1.00
R6032:Smc1b UTSW 15 85066229 missense possibly damaging 0.92
R6032:Smc1b UTSW 15 85066229 missense possibly damaging 0.92
R6049:Smc1b UTSW 15 85121695 missense probably damaging 1.00
R6306:Smc1b UTSW 15 85127623 missense probably benign 0.30
R6392:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6426:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6435:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6436:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6437:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6508:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6512:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6703:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6737:Smc1b UTSW 15 85092031 missense probably benign 0.03
R6775:Smc1b UTSW 15 85089680 missense probably damaging 0.96
R6889:Smc1b UTSW 15 85067759 missense probably damaging 1.00
R6908:Smc1b UTSW 15 85107010 missense probably damaging 1.00
R7124:Smc1b UTSW 15 85071597 missense probably damaging 0.98
R7400:Smc1b UTSW 15 85069720 missense probably damaging 1.00
R7417:Smc1b UTSW 15 85097542 missense probably benign 0.05
R7610:Smc1b UTSW 15 85070820 missense possibly damaging 0.92
R7873:Smc1b UTSW 15 85110650 critical splice donor site probably null
R7890:Smc1b UTSW 15 85066328 missense probably damaging 1.00
R8004:Smc1b UTSW 15 85097614 missense probably damaging 0.98
Z1176:Smc1b UTSW 15 85131903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAGTTTGGAGCAATAAAG -3'
(R):5'- GAAAGCAGTCAAGAGGTTGTCC -3'

Sequencing Primer
(F):5'- GAGCAATAAAGGCATTAAATTTGGC -3'
(R):5'- GCAGTCAAGAGGTTGTCCATTATC -3'
Posted On2015-07-07