Incidental Mutation 'R4420:Zfp763'
ID327074
Institutional Source Beutler Lab
Gene Symbol Zfp763
Ensembl Gene ENSMUSG00000067430
Gene Namezinc finger protein 763
Synonyms
MMRRC Submission 041141-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4420 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33016863-33033402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 33018481 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 563 (K563N)
Ref Sequence ENSEMBL: ENSMUSP00000084936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087654]
Predicted Effect probably benign
Transcript: ENSMUST00000087654
AA Change: K563N

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084936
Gene: ENSMUSG00000067430
AA Change: K563N

DomainStartEndE-ValueType
KRAB 10 60 7.47e-14 SMART
ZnF_C2H2 223 245 2.53e-2 SMART
ZnF_C2H2 251 273 4.54e-4 SMART
ZnF_C2H2 279 301 1.69e-3 SMART
ZnF_C2H2 307 329 5.72e-1 SMART
ZnF_C2H2 335 357 1.64e-1 SMART
ZnF_C2H2 363 385 1.56e-2 SMART
ZnF_C2H2 391 413 1.82e-3 SMART
ZnF_C2H2 419 441 1.64e-1 SMART
ZnF_C2H2 447 469 5.9e-3 SMART
ZnF_C2H2 475 497 2.02e-1 SMART
ZnF_C2H2 503 525 7.15e-2 SMART
ZnF_C2H2 531 553 1.79e-2 SMART
ZnF_C2H2 559 581 5.14e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124465
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef17 G A 7: 100,882,308 probably benign Het
Atp1b1 T C 1: 164,453,558 T53A probably damaging Het
Carmil3 A G 14: 55,493,588 Q104R probably damaging Het
Casz1 T G 4: 148,948,918 N1382K possibly damaging Het
Chfr T A 5: 110,170,880 C585* probably null Het
Chp2 T C 7: 122,221,938 F174S probably damaging Het
Dclre1c A T 2: 3,433,745 probably null Het
Dnah6 A G 6: 73,191,479 V487A probably benign Het
Dnah9 T C 11: 66,118,749 R771G probably benign Het
Duox1 G A 2: 122,327,126 A578T probably benign Het
Elp3 G A 14: 65,580,791 A140V probably damaging Het
Fbrsl1 T C 5: 110,378,986 H387R possibly damaging Het
Gnat3 T C 5: 17,999,801 S151P probably damaging Het
Gucy1a2 T A 9: 3,634,640 L228H probably damaging Het
Gzmn A T 14: 56,166,006 H215Q probably benign Het
Heg1 A T 16: 33,727,435 E864V probably benign Het
Hoxb9 T C 11: 96,271,981 V147A probably benign Het
Hsf5 T G 11: 87,657,304 H604Q probably benign Het
Hus1 T C 11: 9,000,133 E196G probably damaging Het
Il12rb2 G T 6: 67,316,410 probably null Het
Irs1 T C 1: 82,288,450 S682G possibly damaging Het
Jcad T C 18: 4,676,032 S1265P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Matk A G 10: 81,262,457 S361G possibly damaging Het
Mroh5 TGGAG TG 15: 73,783,074 probably benign Het
Nceh1 A G 3: 27,241,649 D353G probably damaging Het
Nqo1 C T 8: 107,392,117 probably null Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Pcdh7 T C 5: 58,129,170 I1196T probably benign Het
Pla2g4d A G 2: 120,284,163 V29A probably benign Het
Ppfibp1 T A 6: 147,026,238 Y794* probably null Het
Prdx5 C A 19: 6,907,964 probably null Het
Psme4 C T 11: 30,812,028 T456I possibly damaging Het
Ptprd A T 4: 76,039,377 S923R possibly damaging Het
Samd12 G A 15: 53,860,259 R13W probably damaging Het
Slc35f4 A T 14: 49,313,577 probably benign Het
Smc1b A G 15: 85,112,830 Y530H probably damaging Het
Spata2l T C 8: 123,234,029 T174A possibly damaging Het
Sugct C T 13: 17,452,545 C241Y probably damaging Het
Tarbp1 G T 8: 126,447,080 A965D possibly damaging Het
Tas1r3 A G 4: 155,862,332 V272A probably damaging Het
Tas2r117 T A 6: 132,803,349 L150* probably null Het
Trip10 C T 17: 57,255,448 P322L probably benign Het
Wdfy3 A C 5: 101,910,984 H1487Q probably damaging Het
Wdr95 G A 5: 149,532,666 V8M probably damaging Het
Zc3h15 C A 2: 83,658,012 A98E probably damaging Het
Zmym2 G A 14: 56,956,878 D1198N probably damaging Het
Zp1 C T 19: 10,914,760 probably null Het
Other mutations in Zfp763
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02638:Zfp763 APN 17 33019934 missense probably benign 0.41
IGL03291:Zfp763 APN 17 33019886 missense probably damaging 0.96
R0346:Zfp763 UTSW 17 33019747 missense probably benign 0.26
R0675:Zfp763 UTSW 17 33019800 missense possibly damaging 0.92
R0683:Zfp763 UTSW 17 33018918 missense probably damaging 1.00
R1494:Zfp763 UTSW 17 33021503 missense probably damaging 0.99
R1521:Zfp763 UTSW 17 33033302 start codon destroyed probably benign 0.03
R1607:Zfp763 UTSW 17 33019907 missense probably benign 0.08
R1627:Zfp763 UTSW 17 33021784 missense probably damaging 1.00
R1714:Zfp763 UTSW 17 33019617 missense probably damaging 0.99
R1993:Zfp763 UTSW 17 33018439 missense probably damaging 1.00
R2109:Zfp763 UTSW 17 33019778 missense probably benign
R4612:Zfp763 UTSW 17 33018948 missense probably benign 0.05
R5114:Zfp763 UTSW 17 33018975 missense probably damaging 0.99
R5426:Zfp763 UTSW 17 33019595 missense probably benign
R5503:Zfp763 UTSW 17 33019533 missense possibly damaging 0.95
R5534:Zfp763 UTSW 17 33021794 missense probably damaging 0.97
R6133:Zfp763 UTSW 17 33018701 missense possibly damaging 0.75
R7141:Zfp763 UTSW 17 33018795 missense probably damaging 0.97
R7365:Zfp763 UTSW 17 33033378 start gained probably benign
R7430:Zfp763 UTSW 17 33019532 missense possibly damaging 0.68
R7552:Zfp763 UTSW 17 33018651 missense probably benign
R8277:Zfp763 UTSW 17 33033320 start gained probably benign
R8446:Zfp763 UTSW 17 33019499 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CACCAGATACACTGCTGTAAAGTTC -3'
(R):5'- ACGGAAGGCGTGTCACAATC -3'

Sequencing Primer
(F):5'- ACACTGCTGTAAAGTTCTCAGC -3'
(R):5'- CATACTGGAGAGAAACCCTATGCATG -3'
Posted On2015-07-07