Mutagenetix > Incidental Mutations

Incidental Mutation 'R4421:Colgalt2'

327078

Institutional Source

Beutler Lab

Gene Symbol

Colgalt2

Ensembl Gene

ENSMUSG00000032649

Gene Name

collagen beta(1-O)galactosyltransferase 2

Synonyms

Glt25d2

MMRRC Submission

041142-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R4421 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

152399830-152510695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 152485012 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 267 (I267F)

Ref Sequence

ENSEMBL: ENSMUSP00000119210 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044311] [ENSMUST00000127586]

AlphaFold

Q6NVG7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044311
AA Change: I267F

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000037532
Gene: ENSMUSG00000032649
AA Change: I267F

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Glyco_tranf_2_4	61	181	1.3e-20	PFAM
Pfam:Glyco_transf_25	340	525	5.8e-41	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000127586
AA Change: I267F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000119210
Gene: ENSMUSG00000032649
AA Change: I267F

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Glyco_tranf_2_4	61	181	4.3e-17	PFAM
Pfam:Glyco_transf_25	340	466	3.2e-37	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acy1	G	C	9: 106,435,713		probably null	Het
Adgrv1	T	C	13: 81,566,302	E234G	probably damaging	Het
Aga	T	C	8: 53,511,826	S8P	probably benign	Het
C1s2	T	C	6: 124,625,215	D673G	probably benign	Het
Capza3	G	A	6: 140,042,042	M122I	probably benign	Het
Cfap44	T	C	16: 44,422,437	S735P	probably damaging	Het
Cntn3	A	G	6: 102,464,547	F13L	probably damaging	Het
Col6a5	A	T	9: 105,928,473	M1078K	unknown	Het
Cpped1	T	C	16: 11,805,357	*299W	probably null	Het
Cyp3a59	A	G	5: 146,104,903		probably null	Het
Ddx42	T	A	11: 106,231,138	Y160N	probably damaging	Het
Dhx35	A	T	2: 158,806,401	R60W	probably damaging	Het
Gbp10	T	C	5: 105,224,651		probably null	Het
Gtf2i	T	C	5: 134,255,037	T467A	possibly damaging	Het
Hip1r	G	C	5: 123,997,862	G542A	possibly damaging	Het
Hspg2	G	A	4: 137,548,122	A2748T	probably benign	Het
Kcnq3	T	C	15: 65,995,511	Y761C	probably benign	Het
Krt13	T	G	11: 100,118,935	T340P	possibly damaging	Het
Map2k5	A	G	9: 63,164,130	C435R	probably damaging	Het
Ms4a4c	T	A	19: 11,416,375	I53K	probably damaging	Het
Myh15	T	A	16: 49,109,344	F544L	probably damaging	Het
Neurod2	G	T	11: 98,328,200	S46*	probably null	Het
Nsd3	T	A	8: 25,641,272	S218T	probably damaging	Het
Olfr1184	A	T	2: 88,487,241	N170Y	probably damaging	Het
Olfr706	G	T	7: 106,886,453	D121E	probably damaging	Het
Prrc2c	TTGCTGCTGCTGCTGCTGCTGCTGCTGC	TTGCTGCTGCTGCTGCTGCTGCTGC	1: 162,709,061		probably benign	Het
Prrg3	A	T	X: 71,967,309	S141C	probably damaging	Het
Ranbp17	A	T	11: 33,475,056	D433E	probably benign	Het
Rbm28	T	C	6: 29,154,837	D278G	probably damaging	Het
Sbpl	A	G	17: 23,954,886	L8P	unknown	Het
Spopl	C	T	2: 23,517,945	V241M	probably damaging	Het
Tdrd3	A	G	14: 87,486,283	E311G	probably damaging	Het
Tma16	C	T	8: 66,484,171		probably null	Het
Ubr4	A	G	4: 139,461,856	N3917D	possibly damaging	Het
Vmn2r68	TCC	TC	7: 85,221,550		probably null	Het
Vmn2r72	T	C	7: 85,738,500	N619D	probably damaging	Het
Xab2	C	A	8: 3,614,244		probably null	Het

Other mutations in Colgalt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01472:Colgalt2	APN	1	152506878	missense	probably damaging	0.98
IGL02900:Colgalt2	APN	1	152508730	missense	probably damaging	0.99
R0280:Colgalt2	UTSW	1	152508561	missense	possibly damaging	0.68
R0282:Colgalt2	UTSW	1	152508561	missense	possibly damaging	0.68
R0328:Colgalt2	UTSW	1	152473108	missense	probably damaging	1.00
R0409:Colgalt2	UTSW	1	152508561	missense	possibly damaging	0.68
R0412:Colgalt2	UTSW	1	152508561	missense	possibly damaging	0.68
R0485:Colgalt2	UTSW	1	152484871	missense	probably damaging	1.00
R0518:Colgalt2	UTSW	1	152508561	missense	possibly damaging	0.68
R0519:Colgalt2	UTSW	1	152508561	missense	possibly damaging	0.68
R0556:Colgalt2	UTSW	1	152471813	splice site	probably benign
R0605:Colgalt2	UTSW	1	152495792	splice site	probably benign
R0628:Colgalt2	UTSW	1	152508561	missense	possibly damaging	0.68
R0972:Colgalt2	UTSW	1	152471744	missense	probably damaging	1.00
R1170:Colgalt2	UTSW	1	152503017	missense	probably damaging	1.00
R1373:Colgalt2	UTSW	1	152473161	missense	probably damaging	1.00
R1452:Colgalt2	UTSW	1	152504153	missense	probably damaging	1.00
R1456:Colgalt2	UTSW	1	152484904	missense	probably damaging	1.00
R1544:Colgalt2	UTSW	1	152484952	missense	probably damaging	1.00
R1707:Colgalt2	UTSW	1	152400363	missense	probably damaging	1.00
R2285:Colgalt2	UTSW	1	152468550	missense	probably benign	0.00
R2917:Colgalt2	UTSW	1	152471744	missense	probably damaging	1.00
R3916:Colgalt2	UTSW	1	152508611	nonsense	probably null
R3917:Colgalt2	UTSW	1	152508611	nonsense	probably null
R4250:Colgalt2	UTSW	1	152489887	missense	probably benign	0.00
R4282:Colgalt2	UTSW	1	152468531	missense	probably damaging	1.00
R4583:Colgalt2	UTSW	1	152506876	missense	probably damaging	1.00
R4743:Colgalt2	UTSW	1	152400343	missense	probably damaging	0.97
R4751:Colgalt2	UTSW	1	152489876	missense	probably benign	0.34
R4832:Colgalt2	UTSW	1	152484998	missense	possibly damaging	0.87
R4930:Colgalt2	UTSW	1	152499959	missense	possibly damaging	0.92
R5319:Colgalt2	UTSW	1	152484869	missense	possibly damaging	0.78
R5504:Colgalt2	UTSW	1	152400303	missense	possibly damaging	0.88
R5916:Colgalt2	UTSW	1	152504122	missense	probably damaging	1.00
R6006:Colgalt2	UTSW	1	152473161	missense	probably damaging	1.00
R6362:Colgalt2	UTSW	1	152471798	missense	probably damaging	1.00
R6837:Colgalt2	UTSW	1	152506828	missense	probably damaging	1.00
R7464:Colgalt2	UTSW	1	152504144	missense	probably damaging	0.97
R8462:Colgalt2	UTSW	1	152503072	missense	probably damaging	1.00
R8725:Colgalt2	UTSW	1	152484911	missense	probably damaging	0.99
R8727:Colgalt2	UTSW	1	152484911	missense	probably damaging	0.99
R9118:Colgalt2	UTSW	1	152503155	intron	probably benign
R9186:Colgalt2	UTSW	1	152508652	missense	probably damaging	0.98
R9393:Colgalt2	UTSW	1	152484847	nonsense	probably null
X0028:Colgalt2	UTSW	1	152471720	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATAATGATGCCTTCAGATGAGAGG -3'
(R):5'- TTCTGGCATGGTTACTACAAGC -3'

Sequencing Primer
(F):5'- CCTTCAGATGAGAGGACATGGTCTC -3'
(R):5'- TGGCATGGTTACTACAAGCACCTC -3'

Posted On

2015-07-07