Incidental Mutation 'R4421:Spopl'
ID327081
Institutional Source Beutler Lab
Gene Symbol Spopl
Ensembl Gene ENSMUSG00000026771
Gene Namespeckle-type POZ protein-like
SynonymsE430033K04Rik, 4921517N04Rik
MMRRC Submission 041142-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4421 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location23506220-23572106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23517945 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 241 (V241M)
Ref Sequence ENSEMBL: ENSMUSP00000114974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028110] [ENSMUST00000132484] [ENSMUST00000132827]
Predicted Effect probably benign
Transcript: ENSMUST00000028110
SMART Domains Protein: ENSMUSP00000141519
Gene: ENSMUSG00000026771

DomainStartEndE-ValueType
MATH 2 108 5.9e-17 SMART
low complexity region 141 152 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132484
AA Change: V241M

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114974
Gene: ENSMUSG00000026771
AA Change: V241M

DomainStartEndE-ValueType
MATH 36 142 9.46e-15 SMART
BTB 200 297 5.99e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132827
SMART Domains Protein: ENSMUSP00000142047
Gene: ENSMUSG00000026771

DomainStartEndE-ValueType
MATH 36 142 5.9e-17 SMART
low complexity region 175 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195415
Meta Mutation Damage Score 0.2768 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with no gross morphological and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acy1 G C 9: 106,435,713 probably null Het
Adgrv1 T C 13: 81,566,302 E234G probably damaging Het
Aga T C 8: 53,511,826 S8P probably benign Het
C1s2 T C 6: 124,625,215 D673G probably benign Het
Capza3 G A 6: 140,042,042 M122I probably benign Het
Cfap44 T C 16: 44,422,437 S735P probably damaging Het
Cntn3 A G 6: 102,464,547 F13L probably damaging Het
Col6a5 A T 9: 105,928,473 M1078K unknown Het
Colgalt2 A T 1: 152,485,012 I267F probably damaging Het
Cpped1 T C 16: 11,805,357 *299W probably null Het
Cyp3a59 A G 5: 146,104,903 probably null Het
Ddx42 T A 11: 106,231,138 Y160N probably damaging Het
Dhx35 A T 2: 158,806,401 R60W probably damaging Het
Gbp10 T C 5: 105,224,651 probably null Het
Gtf2i T C 5: 134,255,037 T467A possibly damaging Het
Hip1r G C 5: 123,997,862 G542A possibly damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Kcnq3 T C 15: 65,995,511 Y761C probably benign Het
Krt13 T G 11: 100,118,935 T340P possibly damaging Het
Map2k5 A G 9: 63,164,130 C435R probably damaging Het
Ms4a4c T A 19: 11,416,375 I53K probably damaging Het
Myh15 T A 16: 49,109,344 F544L probably damaging Het
Neurod2 G T 11: 98,328,200 S46* probably null Het
Nsd3 T A 8: 25,641,272 S218T probably damaging Het
Olfr1184 A T 2: 88,487,241 N170Y probably damaging Het
Olfr706 G T 7: 106,886,453 D121E probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prrg3 A T X: 71,967,309 S141C probably damaging Het
Ranbp17 A T 11: 33,475,056 D433E probably benign Het
Rbm28 T C 6: 29,154,837 D278G probably damaging Het
Sbpl A G 17: 23,954,886 L8P unknown Het
Tdrd3 A G 14: 87,486,283 E311G probably damaging Het
Tma16 C T 8: 66,484,171 probably null Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Vmn2r72 T C 7: 85,738,500 N619D probably damaging Het
Xab2 C A 8: 3,614,244 probably null Het
Other mutations in Spopl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Spopl APN 2 23537631 missense possibly damaging 0.88
P4748:Spopl UTSW 2 23511443 missense probably benign 0.01
PIT4453001:Spopl UTSW 2 23545449 missense probably damaging 0.99
R0738:Spopl UTSW 2 23537521 missense probably benign 0.04
R2358:Spopl UTSW 2 23537380 missense probably damaging 1.00
R3711:Spopl UTSW 2 23537380 missense probably damaging 1.00
R3712:Spopl UTSW 2 23537380 missense probably damaging 1.00
R4097:Spopl UTSW 2 23511401 missense probably benign 0.01
R4400:Spopl UTSW 2 23517945 missense probably damaging 0.97
R4497:Spopl UTSW 2 23517945 missense probably damaging 0.97
R4498:Spopl UTSW 2 23517945 missense probably damaging 0.97
R4570:Spopl UTSW 2 23537485 nonsense probably null
R4702:Spopl UTSW 2 23515297 splice site probably null
R6919:Spopl UTSW 2 23517861 missense probably benign 0.06
R7387:Spopl UTSW 2 23537509 missense probably benign
R7921:Spopl UTSW 2 23545478 missense probably benign
X0067:Spopl UTSW 2 23544867 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTTCCAATAAATAGCAAGTTGGAG -3'
(R):5'- AGGTTCTCACTTAGTAGCTTCAC -3'

Sequencing Primer
(F):5'- AGCAAGTTGGAGGATTTTTGTTTTTG -3'
(R):5'- AGTAGCTTCACTATCTCTGTATGTAC -3'
Posted On2015-07-07